Rmu_sc0003512.1_g000014

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003512.1
OG0005646
Physical Location & Seq
Forward (+)
67655 .. 68462
808 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003512.1_g000014.1.cds

Sequence Viewer

Length: 684 bp
atggcctctatagatgctgtaatagcaagttttgctgcttctcttgctctcacttcgggtggtagcaccccagatctgggaaagattggcggtggtcctgtgcgtaggtcctcccaatcttttctacttggcaaacctttgactcggaagccggtggatcccaaagcttttaaagctcactttcatctttgttttgaagagtatgatggcatcaagcctcttcatgaagtccattttaagtatgtttgtgtttgggttagggtttcagagatccctcctttgtatgaagaacctgagaacttcactcttatcggtaatcttttgggtggcttcttagattaccataagaaggaattcaagaagggattgattcggatcttggttactcatgatatctccaaaccagtcttacttgagcgtaaatttttcttggatgttggtgtcaaatctatgctacagtttcaatttgagcatatgaaaaggagatgttcacaatgtggtctgatcacacatgttgggatttcgtgtgaggagccgaacactacaatttcggcacctagggttttaagctttccgagaccctcgacctcaggaggttcattttccttctcaactcagaataaacgtgatgtcttcactgcttcctccttcattcccaagaagaagaagccctttattcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 Exo_endo_phos_2 RNase_H RVT_1 zf-CCHC_4

Protein Analysis

227

Amino Acids

25.36

Weight (kDa)

9.53

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 553
AciI CCGC 1 cut(s) 90
AclWI GGATC 4 cut(s) 152, 165, 265, 383
AcsI RAATTY 2 cut(s) 353, 422
AdeI CACNNNGTG 1 cut(s) 497
AfiI CCNNNNNNNGG 3 cut(s) 76, 77, 349
AflIII ACRYGT 1 cut(s) 511
AgsI TTSAA 3 cut(s) 197, 358, 464
AluBI AGCT 3 cut(s) 167, 176, 570
AluI AGCT 3 cut(s) 167, 176, 570
Alw26I GTCTC 1 cut(s) 571
AlwI GGATC 4 cut(s) 152, 165, 265, 383
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 2 cut(s) 353, 422
Asp700I GAANNNNTTC 1 cut(s) 353
AspA2I CCTAGG 1 cut(s) 557
AspS9I GGNCC 2 cut(s) 95, 108
AvaII GGWCC 2 cut(s) 95, 108
AvrII CCTAGG 1 cut(s) 557
AxyI CCTNAGG 1 cut(s) 589
BamHI GGATCC 1 cut(s) 157
BanI GGYRCC 1 cut(s) 553
BbsI GAAGAC 1 cut(s) 625
BbvI GCAGC 1 cut(s) 22
BccI CCATC 1 cut(s) 200
BclI TGATCA 1 cut(s) 504
BcoDI GTCTC 1 cut(s) 571
BfaI CTAG 1 cut(s) 558
BfmI CTRYAG 2 cut(s) 9, 455
BglII AGATCT 1 cut(s) 73
BisI GCNGC 1 cut(s) 36
BlnI CCTAGG 1 cut(s) 557
BlsI GCNGC 1 cut(s) 37
Bme18I GGWCC 2 cut(s) 95, 108
BmgT120I GGNCC 2 cut(s) 95, 108
BmiI GGNNCC 3 cut(s) 159, 534, 555
BmsI GCATC 2 cut(s) 4, 219
BpiI GAAGAC 1 cut(s) 625
BpuEI CTTGAG 1 cut(s) 434
BsaBI GATNNNNATC 1 cut(s) 374
BsaI GGTCTC 1 cut(s) 571
BsaJI CCNNGG 1 cut(s) 557
Bsc4I CCNNNNNNNGG 3 cut(s) 76, 77, 349
Bse118I RCCGGY 1 cut(s) 151
Bse1I ACTGG 1 cut(s) 404
Bse21I CCTNAGG 1 cut(s) 589
Bse8I GATNNNNATC 1 cut(s) 374
BseDI CCNNGG 1 cut(s) 557
BseGI GGATG 1 cut(s) 439
BseJI GATNNNNATC 1 cut(s) 374
BseLI CCNNNNNNNGG 3 cut(s) 76, 77, 349
BseMII CTCAG 3 cut(s) 285, 603, 629
BseNI ACTGG 1 cut(s) 404
BseRI GAGGAG 1 cut(s) 545
BseXI GCAGC 1 cut(s) 22
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 553
BsiSI CCGG 1 cut(s) 152
BslI CCNNNNNNNGG 3 cut(s) 76, 77, 349
BsmAI GTCTC 1 cut(s) 571
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 571
Bsp143I GATC 5 cut(s) 73, 157, 270, 375, 504
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 3 cut(s) 286, 602, 628
BspHI TCATGA 2 cut(s) 223, 388
BspLI GGNNCC 3 cut(s) 159, 534, 555
BspPI GGATC 4 cut(s) 152, 165, 265, 383
BspT107I GGYRCC 1 cut(s) 553
BspTNI GGTCTC 1 cut(s) 571
BsrFI RCCGGY 1 cut(s) 151
BsrI ACTGG 1 cut(s) 404
BssAI RCCGGY 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 557
BssMI GATC 5 cut(s) 73, 157, 270, 375, 504
BssT1I CCWWGG 1 cut(s) 557
Bst4CI ACNGT 1 cut(s) 459
Bst6I CTCTTC 2 cut(s) 192, 225
BstAPI GCANNNNNTGC 1 cut(s) 32
BstDEI CTNAG 4 cut(s) 294, 334, 589, 615
BstF5I GGATG 1 cut(s) 439
BstKTI GATC 5 cut(s) 76, 160, 273, 378, 507
BstMAI GTCTC 1 cut(s) 571
BstMBI GATC 5 cut(s) 73, 157, 270, 375, 504
BstMWI GCNNNNNNNGC 4 cut(s) 23, 32, 44, 173
BstNSI RCATGY 1 cut(s) 515
BstSFI CTRYAG 2 cut(s) 9, 455
BstV1I GCAGC 1 cut(s) 22
BstV2I GAAGAC 1 cut(s) 625
BstX2I RGATCY 4 cut(s) 73, 157, 270, 375
BstYI RGATCY 4 cut(s) 73, 157, 270, 375
Bsu36I CCTNAGG 1 cut(s) 589
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 439
BtsI GCAGTG 1 cut(s) 636
BtsIMutI CAGTG 2 cut(s) 636, 679
CciI TCATGA 2 cut(s) 223, 388
Cfr10I RCCGGY 1 cut(s) 151
Cfr13I GGNCC 2 cut(s) 95, 108
CviAII CATG 3 cut(s) 224, 389, 512
CviJI RGCY 9 cut(s) 5, 151, 167, 176, 217, 330, 535, 570, 670
CviKI_1 RGCY 9 cut(s) 5, 151, 167, 176, 217, 330, 535, 570, 670
DdeI CTNAG 4 cut(s) 294, 334, 589, 615
DpnI GATC 5 cut(s) 75, 159, 272, 377, 506
DpnII GATC 5 cut(s) 73, 157, 270, 375, 504
DraI TTTAAA 1 cut(s) 172
DraIII CACNNNGTG 1 cut(s) 497
Eam1104I CTCTTC 2 cut(s) 192, 225
EarI CTCTTC 2 cut(s) 192, 225
Eco130I CCWWGG 1 cut(s) 557
Eco31I GGTCTC 1 cut(s) 571
Eco32I GATATC 1 cut(s) 394
Eco47I GGWCC 2 cut(s) 95, 108
Eco81I CCTNAGG 1 cut(s) 589
EcoO109I RGGNCCY 1 cut(s) 108
EcoRI GAATTC 1 cut(s) 353
EcoRV GATATC 1 cut(s) 394
EcoT14I CCWWGG 1 cut(s) 557
ErhI CCWWGG 1 cut(s) 557
FaeI CATG 3 cut(s) 227, 392, 515
FalI AAGNNNNNCTT 1 cut(s) 656
FatI CATG 3 cut(s) 223, 388, 511
FauNDI CATATG 1 cut(s) 474
FbaI TGATCA 1 cut(s) 504
Fnu4HI GCNGC 1 cut(s) 36
FokI GGATG 1 cut(s) 446
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 1 cut(s) 558
GluI GCNGC 1 cut(s) 36
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 152
Hin1II CATG 3 cut(s) 227, 392, 515
HindIII AAGCTT 2 cut(s) 165, 568
HinfI GANTC 2 cut(s) 142, 370
HpaII CCGG 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 491
Hpy188I TCNGA 6 cut(s) 147, 268, 375, 504, 576, 618
Hpy188III TCNNGA 4 cut(s) 224, 358, 389, 591
Hpy8I GTNNAC 1 cut(s) 491
HpyAV CCTTC 4 cut(s) 343, 355, 616, 658
HpyCH4III ACNGT 1 cut(s) 459
HpyCH4IV ACGT 1 cut(s) 625
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 32, 44, 173
HpyF3I CTNAG 4 cut(s) 294, 334, 589, 615
HpySE526I ACGT 1 cut(s) 625
Hsp92II CATG 3 cut(s) 227, 392, 515
Ksp22I TGATCA 1 cut(s) 504
Kzo9I GATC 5 cut(s) 73, 157, 270, 375, 504
LmnI GCTCC 1 cut(s) 532
LpnPI CCDG 7 cut(s) 62, 84, 111, 165, 306, 417, 576
Lsp1109I GCAGC 1 cut(s) 22
LweI GCATC 2 cut(s) 4, 219
MaeI CTAG 1 cut(s) 558
MaeII ACGT 1 cut(s) 625
MaeIII GTNAC 1 cut(s) 382
MalI GATC 5 cut(s) 75, 159, 272, 377, 506
MboI GATC 5 cut(s) 73, 157, 270, 375, 504
MboII GAAGA 6 cut(s) 209, 212, 299, 625, 673, 676
MflI RGATCY 4 cut(s) 73, 157, 270, 375
MluCI AATT 4 cut(s) 353, 422, 464, 546
MlyI GAGTC 1 cut(s) 136
MnlI CCTC 9 cut(s) 16, 121, 228, 285, 523, 587, 592, 598, 655
MroXI GAANNNNTTC 1 cut(s) 353
MseI TTAA 3 cut(s) 171, 237, 566
MspI CCGG 1 cut(s) 152
MwoI GCNNNNNNNGC 4 cut(s) 23, 32, 44, 173
NdeI CATATG 1 cut(s) 474
NdeII GATC 5 cut(s) 73, 157, 270, 375, 504
NlaIII CATG 3 cut(s) 227, 392, 515
NlaIV GGNNCC 3 cut(s) 159, 534, 555
NspI RCATGY 1 cut(s) 515
PagI TCATGA 2 cut(s) 223, 388
PciI ACATGT 1 cut(s) 511
PdmI GAANNNNTTC 1 cut(s) 353
PfeI GAWTC 1 cut(s) 370
PkrI GCNGC 1 cut(s) 37
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
PpuMI RGGWCCY 1 cut(s) 108
PscI ACATGT 1 cut(s) 511
Psp5II RGGWCCY 1 cut(s) 108
PspN4I GGNNCC 3 cut(s) 159, 534, 555
PspPI GGNCC 2 cut(s) 95, 108
PspPPI RGGWCCY 1 cut(s) 108
PsuI RGATCY 4 cut(s) 73, 157, 270, 375
SaqAI TTAA 3 cut(s) 171, 237, 566
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 5 cut(s) 73, 157, 270, 375, 504
Sau96I GGNCC 2 cut(s) 95, 108
SchI GAGTC 1 cut(s) 136
SfaNI GCATC 2 cut(s) 4, 219
SfcI CTRYAG 2 cut(s) 9, 455
SinI GGWCC 2 cut(s) 95, 108
SmlI CTYRAG 1 cut(s) 413
SmoI CTYRAG 1 cut(s) 413
Sse9I AATT 4 cut(s) 353, 422, 464, 546
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 558
StyI CCWWGG 1 cut(s) 557
TaaI ACNGT 1 cut(s) 459
TaiI ACGT 1 cut(s) 628
TaqI TCGA 1 cut(s) 584
TasI AATT 4 cut(s) 353, 422, 464, 546
TfiI GAWTC 1 cut(s) 370
Tru1I TTAA 3 cut(s) 171, 237, 566
Tru9I TTAA 3 cut(s) 171, 237, 566
TscAI CASTG 1 cut(s) 643
TseI GCWGC 1 cut(s) 35
TspDTI ATGAA 7 cut(s) 173, 212, 240, 300, 491, 588, 640
TspRI CASTG 1 cut(s) 643
VpaK11BI GGWCC 2 cut(s) 95, 108
XapI RAATTY 2 cut(s) 353, 422
XceI RCATGY 1 cut(s) 515
XmaJI CCTAGG 1 cut(s) 557
XmnI GAANNNNTTC 1 cut(s) 353
XspI CTAG 1 cut(s) 558
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.