AT2G37975

Protein transport protein yos1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0001813
Physical Location & Seq
Reverse (-)
15891735 .. 15893639
1905 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G37975.1

Sequence Viewer

Length: 237 bp
ATGGGGTTCTGGACACTAATGGAAGGATTGCTACTATTTGCAAACGCACTGGCTATCTTAAACGAAGACCGTTTTCTAGCTCCCAAAGGATGGACGCTCGCAGAACTCCACCAAACGGGCAAAAGAAACTCTCTCAAAGGCCAAATCATTGGTCTCATCCACGCCTGTCATTACATGAGGCTTCCTCTCATGCTCTTTAACTTAATTGTCATTGTCTTTAAGCTTTTCTCTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yos1

Protein Analysis

78

Amino Acids

8.86

Weight (kDa)

9.51

Isoelectric Point (pI)

33.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yos1 PF08571 3 - 78 1.7e-25 Yos1-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 90
AfiI CCNNNNNNNGG 2 cut(s) 90, 115
AluBI AGCT 2 cut(s) 80, 223
AluI AGCT 2 cut(s) 80, 223
Alw26I GTCTC 1 cut(s) 158
AoxI GGCC 1 cut(s) 139
ArsI GACNNNNNNTTYG 2 cut(s) 136, 168
BarI GAAGNNNNNNTAC 2 cut(s) 15, 47
BbsI GAAGAC 1 cut(s) 72
BccI CCATC 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 158
BfaI CTAG 1 cut(s) 77
BpiI GAAGAC 1 cut(s) 72
BplI GAGNNNNNCTC 2 cut(s) 169, 201
BsaI GGTCTC 1 cut(s) 158
Bsc4I CCNNNNNNNGG 2 cut(s) 90, 115
Bse1I ACTGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 95, 156
BseLI CCNNNNNNNGG 2 cut(s) 90, 115
BseNI ACTGG 1 cut(s) 54
BshFI GGCC 1 cut(s) 141
BslI CCNNNNNNNGG 2 cut(s) 90, 115
BsmAI GTCTC 1 cut(s) 158
BsnI GGCC 1 cut(s) 141
Bso31I GGTCTC 1 cut(s) 158
BspANI GGCC 1 cut(s) 141
BspTNI GGTCTC 1 cut(s) 158
BsrI ACTGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 99
BstF5I GGATG 2 cut(s) 95, 156
BstMAI GTCTC 1 cut(s) 158
BstV2I GAAGAC 1 cut(s) 72
BstXI CCANNNNNNTGG 1 cut(s) 149
BsuRI GGCC 1 cut(s) 141
BtsCI GGATG 2 cut(s) 95, 156
BtsIMutI CAGTG 1 cut(s) 47
Cac8I GCNNGC 1 cut(s) 99
CseI GACGC 1 cut(s) 103
CviAII CATG 2 cut(s) 175, 190
CviJI RGCY 5 cut(s) 53, 80, 141, 181, 223
CviKI_1 RGCY 5 cut(s) 53, 80, 141, 181, 223
Eco31I GGTCTC 1 cut(s) 158
FaeI CATG 2 cut(s) 178, 193
FaiI YATR 2 cut(s) 176, 191
FatI CATG 2 cut(s) 174, 189
FokI GGATG 2 cut(s) 102, 143
FspBI CTAG 1 cut(s) 77
HaeIII GGCC 1 cut(s) 141
HgaI GACGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 178, 193
HindIII AAGCTT 1 cut(s) 221
Hpy188III TCNNGA 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 41
Hsp92II CATG 2 cut(s) 178, 193
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 3 cut(s) 35, 178, 216
MaeI CTAG 1 cut(s) 77
MboII GAAGA 1 cut(s) 77
MluCI AATT 1 cut(s) 204
MnlI CCTC 2 cut(s) 171, 195
MseI TTAA 5 cut(s) 59, 198, 203, 219, 235
NlaIII CATG 2 cut(s) 178, 193
PflMI CCANNNNNTGG 1 cut(s) 90
SaqAI TTAA 5 cut(s) 59, 198, 203, 219, 235
SetI ASST 2 cut(s) 82, 225
SgeI CNNG 9 cut(s) 22, 62, 89, 110, 129, 173, 177, 187, 202
Sse9I AATT 1 cut(s) 204
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 71
TasI AATT 1 cut(s) 204
Tru1I TTAA 5 cut(s) 59, 198, 203, 219, 235
Tru9I TTAA 5 cut(s) 59, 198, 203, 219, 235
TscAI CASTG 1 cut(s) 54
TspRI CASTG 1 cut(s) 54
Van91I CCANNNNNTGG 1 cut(s) 90
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.