Prupe.6G268600_v2.0.a1

Protein transport protein yos1-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
25590620 .. 25591789
1170 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G268600.1

Sequence Viewer

Length: 255 bp
ATGTTCCCTCTTCTCTCCTTTTTCACGGGGTTTGTGACTTTGATCCAAGGCTTTTTGCTACTTGCAAATGCATTTGCAGTACTGAATGAGGATCGCTTTCTTGATCCGAGGGGGTGGACCTTGCTACAAATTCAAGGAGGAAGAACCACGCTTAAGGGAAAGATCATAGGGCTTATACATTTATGCCAATTCTTGAGATTACCTCTCATAATTTTAAACATCGTAGTTATTGTATTTAAGCTAATCTTTGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.49

Weight (kDa)

10.28

Isoelectric Point (pI)

17.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 37, 98, 99
AcsI RAATTY 1 cut(s) 129
AfaI GTAC 1 cut(s) 81
AflII CTTAAG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
AlwI GGATC 3 cut(s) 37, 98, 99
ApoI RAATTY 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 117
AvaII GGWCC 1 cut(s) 117
BfrI CTTAAG 1 cut(s) 152
BmcAI AGTACT 1 cut(s) 81
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 117
BplI GAGNNNNNCTC 2 cut(s) 187, 219
BpuEI CTTGAG 1 cut(s) 214
BsaJI CCNNGG 2 cut(s) 46, 107
BseDI CCNNGG 2 cut(s) 46, 107
Bsp143I GATC 4 cut(s) 42, 91, 103, 162
BspPI GGATC 3 cut(s) 37, 98, 99
BspTI CTTAAG 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 46, 107
BssMI GATC 4 cut(s) 42, 91, 103, 162
BssT1I CCWWGG 1 cut(s) 46
Bst6I CTCTTC 1 cut(s) 15
BstAFI CTTAAG 1 cut(s) 152
BstKTI GATC 4 cut(s) 45, 94, 106, 165
BstMBI GATC 4 cut(s) 42, 91, 103, 162
Cfr13I GGNCC 1 cut(s) 117
Csp6I GTAC 1 cut(s) 80
CviJI RGCY 3 cut(s) 51, 172, 241
CviKI_1 RGCY 3 cut(s) 51, 172, 241
CviQI GTAC 1 cut(s) 80
DpnI GATC 4 cut(s) 44, 93, 105, 164
DpnII GATC 4 cut(s) 42, 91, 103, 162
DraI TTTAAA 1 cut(s) 216
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco130I CCWWGG 1 cut(s) 46
Eco47I GGWCC 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 46
FaiI YATR 4 cut(s) 167, 176, 184, 209
FalI AAGNNNNNCTT 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 2 cut(s) 101, 193
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4V TGCA 3 cut(s) 65, 71, 77
Kzo9I GATC 4 cut(s) 42, 91, 103, 162
MaeIII GTNAC 1 cut(s) 34
MalI GATC 4 cut(s) 44, 93, 105, 164
MboI GATC 4 cut(s) 42, 91, 103, 162
MboII GAAGA 1 cut(s) 153
MluCI AATT 3 cut(s) 129, 188, 210
MnlI CCTC 5 cut(s) 18, 82, 102, 131, 213
Mph1103I ATGCAT 1 cut(s) 73
MseI TTAA 3 cut(s) 153, 215, 237
MspCI CTTAAG 1 cut(s) 152
NdeII GATC 4 cut(s) 42, 91, 103, 162
NmuCI GTSAC 1 cut(s) 34
NsiI ATGCAT 1 cut(s) 73
PspPI GGNCC 1 cut(s) 117
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 3 cut(s) 153, 215, 237
Sau3AI GATC 4 cut(s) 42, 91, 103, 162
Sau96I GGNCC 1 cut(s) 117
ScaI AGTACT 1 cut(s) 81
SetI ASST 3 cut(s) 122, 205, 243
SinI GGWCC 1 cut(s) 117
SmlI CTYRAG 2 cut(s) 152, 193
SmoI CTYRAG 2 cut(s) 152, 193
Sse9I AATT 3 cut(s) 129, 188, 210
StyI CCWWGG 1 cut(s) 46
TasI AATT 3 cut(s) 129, 188, 210
TatI WGTACW 1 cut(s) 79
Tru1I TTAA 3 cut(s) 153, 215, 237
Tru9I TTAA 3 cut(s) 153, 215, 237
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
Vha464I CTTAAG 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 117
XapI RAATTY 1 cut(s) 129
ZrmI AGTACT 1 cut(s) 81
Zsp2I ATGCAT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.