Rmu_sc0012140.1_g000012

Protein transport protein yos1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012140.1
Physical Location & Seq
Forward (+)
50244 .. 50549
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012140.1_g000012.1.cds

Sequence Viewer

Length: 306 bp
atgcttctcggttttggctttggttttgcttcggtgttttggaatgccttttggactttgtttcgtggatttgtggctggactgctattttgcaatgccatggctgtactgaatgagcacaggtttctaggtcgaatggggctaactctgaaagatgatggagctggggatgagaggaagaagctcatcactttcaagtattgggtcacacggattttacaggcagcccgatggtcgaggcaaatcctcatattggtgaacggcatcattatttgcattctgttgttgcttgggtactggctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.62

Weight (kDa)

10.03

Isoelectric Point (pI)

21.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 108, 296
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 1 cut(s) 196
AluBI AGCT 2 cut(s) 164, 184
AluI AGCT 2 cut(s) 164, 184
Alw21I GWGCWC 1 cut(s) 120
ApeKI GCWGC 1 cut(s) 224
ArsI GACNNNNNNTTYG 2 cut(s) 72, 104
AsuHPI GGTGA 1 cut(s) 268
Bbv12I GWGCWC 1 cut(s) 120
BbvI GCAGC 1 cut(s) 236
BccI CCATC 2 cut(s) 152, 225
BceAI ACGGC 1 cut(s) 277
BfaI CTAG 1 cut(s) 128
BfmI CTRYAG 1 cut(s) 302
BisI GCNGC 1 cut(s) 225
BlsI GCNGC 1 cut(s) 226
BmsI GCATC 1 cut(s) 273
BsaJI CCNNGG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 253
Bse1I ACTGG 1 cut(s) 302
Bse3DI GCAATG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 99
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 253
BseMI GCAATG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 302
BseXI GCAGC 1 cut(s) 236
BseYI CCCAGC 1 cut(s) 164
BsiHKAI GWGCWC 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 253
BsmI GAATGC 2 cut(s) 49, 276
Bsp1286I GDGCHC 1 cut(s) 120
Bsp19I CCATGG 1 cut(s) 99
BsrDI GCAATG 1 cut(s) 100
BsrI ACTGG 1 cut(s) 302
BssECI CCNNGG 1 cut(s) 99
BssT1I CCWWGG 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 99
BstF5I GGATG 1 cut(s) 175
BstSFI CTRYAG 1 cut(s) 302
BstV1I GCAGC 1 cut(s) 236
BtgI CCRYGG 1 cut(s) 99
BtsCI GGATG 1 cut(s) 175
Csp6I GTAC 2 cut(s) 107, 295
CviAII CATG 1 cut(s) 100
CviJI RGCY 8 cut(s) 18, 77, 104, 142, 164, 184, 227, 301
CviKI_1 RGCY 8 cut(s) 18, 77, 104, 142, 164, 184, 227, 301
CviQI GTAC 2 cut(s) 107, 295
Eco130I CCWWGG 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 103
FaiI YATR 2 cut(s) 101, 251
FatI CATG 1 cut(s) 99
Fnu4HI GCNGC 1 cut(s) 225
FokI GGATG 1 cut(s) 182
Fsp4HI GCNGC 1 cut(s) 225
FspBI CTAG 1 cut(s) 128
GluI GCNGC 1 cut(s) 225
GsaI CCCAGC 1 cut(s) 168
Hin1II CATG 1 cut(s) 103
HphI GGTGA 1 cut(s) 268
Hpy166II GTNNAC 1 cut(s) 259
Hpy188I TCNGA 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 259
HpyCH4V TGCA 2 cut(s) 93, 276
Hsp92II CATG 1 cut(s) 103
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 5 cut(s) 63, 106, 150, 206, 283
Lsp1109I GCAGC 1 cut(s) 236
LweI GCATC 1 cut(s) 273
MaeI CTAG 1 cut(s) 128
MaeIII GTNAC 1 cut(s) 205
MboII GAAGA 1 cut(s) 190
MhlI GDGCHC 1 cut(s) 120
MnlI CCTC 3 cut(s) 168, 231, 257
MslI CAYNNNNRTG 1 cut(s) 254
Mva1269I GAATGC 2 cut(s) 49, 276
NcoI CCATGG 1 cut(s) 99
NlaIII CATG 1 cut(s) 103
NmuCI GTSAC 1 cut(s) 205
PctI GAATGC 2 cut(s) 49, 276
PkrI GCNGC 1 cut(s) 226
PspFI CCCAGC 1 cut(s) 164
RsaI GTAC 2 cut(s) 108, 296
RsaNI GTAC 2 cut(s) 107, 295
RseI CAYNNNNRTG 1 cut(s) 254
SatI GCNGC 1 cut(s) 225
SduI GDGCHC 1 cut(s) 120
SetI ASST 4 cut(s) 125, 133, 166, 186
SfaNI GCATC 1 cut(s) 273
SfcI CTRYAG 1 cut(s) 302
SmiMI CAYNNNNRTG 1 cut(s) 254
SspMI CTAG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 99
TaqI TCGA 2 cut(s) 133, 236
TatI WGTACW 1 cut(s) 106
TseFI GTSAC 1 cut(s) 205
TseI GCWGC 1 cut(s) 224
Tsp45I GTSAC 1 cut(s) 205
TspGWI ACGGA 1 cut(s) 226
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.