Rh3BG131800

Protein transport protein yos1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0001813
Physical Location & Seq
Forward (+)
11114547 .. 11115207
661 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG131800.1

Sequence Viewer

Length: 345 bp
ATGCAAAATGTCAAAGGGTTTAGTTTCTGTGTCGTCGAAATCAAGGCCAGAGCTTTAAAGTTTAAACGGAGAAAACAAGTTCATCTTCTCTATAAACAAATCTCGCTGAAGATGGGTTTATGGACTTTGATTCAAGGCATGTTGCTATTTGCAAACGGGTTGGCGATTCTGAACGAGGATCGGTTTCTTGCTCCTAGAGGTTGGACCATGTTAGAGGTTCAAAGAGGGAATCGAAGTACGATGAAGGGGCAGCTTATAGGACTTATATATGCCTGCCAGTACTTCAGAATTATGCTCGTTTTCTTCAACTTCATAACTATTATTCTCAAGCTCATATATGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yos1

Protein Analysis

114

Amino Acids

13.34

Weight (kDa)

10.49

Isoelectric Point (pI)

26.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yos1 PF08571 40 - 114 3.7e-22 Yos1-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 186
AcuI CTGAAG 2 cut(s) 128, 268
AfaI GTAC 2 cut(s) 238, 281
AgsI TTSAA 3 cut(s) 134, 221, 307
AluBI AGCT 3 cut(s) 53, 253, 331
AluI AGCT 3 cut(s) 53, 253, 331
AlwI GGATC 1 cut(s) 186
AoxI GGCC 1 cut(s) 45
ApeKI GCWGC 1 cut(s) 250
AspS9I GGNCC 1 cut(s) 204
AvaII GGWCC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 262
BccI CCATC 1 cut(s) 106
BfaI CTAG 1 cut(s) 195
BisI GCNGC 1 cut(s) 251
BlsI GCNGC 1 cut(s) 252
BmcAI AGTACT 1 cut(s) 281
Bme18I GGWCC 1 cut(s) 204
BmgT120I GGNCC 1 cut(s) 204
BpuEI CTTGAG 1 cut(s) 311
Bse1I ACTGG 1 cut(s) 277
BseNI ACTGG 1 cut(s) 277
BseXI GCAGC 1 cut(s) 262
BshFI GGCC 1 cut(s) 47
BsnI GGCC 1 cut(s) 47
Bsp143I GATC 1 cut(s) 178
BspANI GGCC 1 cut(s) 47
BspPI GGATC 1 cut(s) 186
BsrI ACTGG 1 cut(s) 277
BssMI GATC 1 cut(s) 178
BstC8I GCNNGC 1 cut(s) 274
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstNSI RCATGY 1 cut(s) 142
BstV1I GCAGC 1 cut(s) 262
BsuRI GGCC 1 cut(s) 47
Cac8I GCNNGC 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 204
Csp6I GTAC 2 cut(s) 237, 280
CviAII CATG 2 cut(s) 139, 208
CviJI RGCY 4 cut(s) 47, 53, 253, 331
CviKI_1 RGCY 4 cut(s) 47, 53, 253, 331
CviQI GTAC 2 cut(s) 237, 280
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
DraI TTTAAA 2 cut(s) 57, 64
Eco47I GGWCC 1 cut(s) 204
Eco57I CTGAAG 2 cut(s) 128, 268
FaeI CATG 2 cut(s) 142, 211
FalI AAGNNNNNCTT 2 cut(s) 69, 101
FatI CATG 2 cut(s) 138, 207
Fnu4HI GCNGC 1 cut(s) 251
Fsp4HI GCNGC 1 cut(s) 251
FspBI CTAG 1 cut(s) 195
GluI GCNGC 1 cut(s) 251
HaeIII GGCC 1 cut(s) 47
Hin1II CATG 2 cut(s) 142, 211
HinfI GANTC 3 cut(s) 130, 166, 229
Hpy188I TCNGA 2 cut(s) 171, 287
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 238
HpyCH4V TGCA 2 cut(s) 4, 152
Hsp92II CATG 2 cut(s) 142, 211
Kzo9I GATC 1 cut(s) 178
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 3 cut(s) 61, 286, 290
Lsp1109I GCAGC 1 cut(s) 262
MaeI CTAG 1 cut(s) 195
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 3 cut(s) 77, 121, 295
MluCI AATT 1 cut(s) 288
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 4 cut(s) 169, 191, 208, 218
MseI TTAA 2 cut(s) 56, 63
MssI GTTTAAAC 1 cut(s) 64
NdeII GATC 1 cut(s) 178
NlaIII CATG 2 cut(s) 142, 211
NspI RCATGY 1 cut(s) 142
PfeI GAWTC 3 cut(s) 130, 166, 229
PkrI GCNGC 1 cut(s) 252
PmeI GTTTAAAC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 204
RsaI GTAC 2 cut(s) 238, 281
RsaNI GTAC 2 cut(s) 237, 280
SaqAI TTAA 2 cut(s) 56, 63
SatI GCNGC 1 cut(s) 251
Sau3AI GATC 1 cut(s) 178
Sau96I GGNCC 1 cut(s) 204
ScaI AGTACT 1 cut(s) 281
SetI ASST 5 cut(s) 55, 202, 219, 255, 333
SinI GGWCC 1 cut(s) 204
SmlI CTYRAG 1 cut(s) 326
SmoI CTYRAG 1 cut(s) 326
Sse9I AATT 1 cut(s) 288
SspMI CTAG 1 cut(s) 195
TaqI TCGA 2 cut(s) 36, 232
TasI AATT 1 cut(s) 288
TatI WGTACW 1 cut(s) 279
TfiI GAWTC 3 cut(s) 130, 166, 229
Tru1I TTAA 2 cut(s) 56, 63
Tru9I TTAA 2 cut(s) 56, 63
TseI GCWGC 1 cut(s) 250
TspDTI ATGAA 3 cut(s) 71, 257, 301
TspGWI ACGGA 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 204
XceI RCATGY 1 cut(s) 142
XspI CTAG 1 cut(s) 195
ZrmI AGTACT 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.