FvH4_7g23790

Immediate early response 3-interacting protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0001813
Physical Location & Seq
Reverse (-)
18488208 .. 18490861
2654 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g23790.t8

Sequence Viewer

Length: 234 bp
ATGGGTTTGTGGACGCTACTTGAAGGCTTCTTGCTTCTTGCAAATGCTCTAGCAATATTAAATGAGGACCGCTTCCTTGCGCCTAGGGGTTGGAGCTTCTCAGAATTCTCTGTGGGCAGGACAAAGTCATTGAAGGGACAAATTATAGGCCTCATTTATGCAACACAGTATCTGAGAGTTCCTCTGGTGCTACTCAATTCTATCTTCATTGTTGTAAAATTGATATCTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yos1

Protein Analysis

78

Amino Acids

8.57

Weight (kDa)

9.82

Isoelectric Point (pI)

19.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yos1 PF08571 3 - 77 2.3e-25 Yos1-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 104
AgsI TTSAA 2 cut(s) 23, 133
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
AlwNI CAGNNNCTG 1 cut(s) 172
AoxI GGCC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 104
AspA2I CCTAGG 1 cut(s) 83
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 67
AvaII GGWCC 1 cut(s) 67
AvrII CCTAGG 1 cut(s) 83
BfaI CTAG 2 cut(s) 50, 84
BlnI CCTAGG 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BplI GAGNNNNNCTC 2 cut(s) 166, 198
BsaJI CCNNGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 83
BseMII CTCAG 2 cut(s) 114, 164
BshFI GGCC 1 cut(s) 150
BslFI GGGAC 1 cut(s) 150
BsmFI GGGAC 1 cut(s) 150
BsnI GGCC 1 cut(s) 150
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 2 cut(s) 113, 165
BssECI CCNNGG 1 cut(s) 83
BssT1I CCWWGG 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 168
BstDEI CTNAG 2 cut(s) 100, 173
BstHHI GCGC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 150
CaiI CAGNNNCTG 1 cut(s) 172
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 67
CseI GACGC 1 cut(s) 22
CviJI RGCY 3 cut(s) 27, 96, 150
CviKI_1 RGCY 3 cut(s) 27, 96, 150
DdeI CTNAG 2 cut(s) 100, 173
Eco130I CCWWGG 1 cut(s) 83
Eco147I AGGCCT 1 cut(s) 150
Eco32I GATATC 1 cut(s) 225
Eco47I GGWCC 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 104
EcoRV GATATC 1 cut(s) 225
EcoT14I CCWWGG 1 cut(s) 83
ErhI CCWWGG 1 cut(s) 83
FaiI YATR 2 cut(s) 146, 159
FaqI GGGAC 1 cut(s) 150
FspBI CTAG 2 cut(s) 50, 84
GlaI GCGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 150
HgaI GACGC 1 cut(s) 22
HhaI GCGC 1 cut(s) 82
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 103, 174
Hpy188III TCNNGA 1 cut(s) 228
Hpy8I GTNNAC 1 cut(s) 12
HpyAV CCTTC 2 cut(s) 17, 127
HpyCH4III ACNGT 1 cut(s) 168
HpyCH4V TGCA 2 cut(s) 41, 161
HpyF3I CTNAG 2 cut(s) 100, 173
HspAI GCGC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 3 cut(s) 103, 170, 213
MaeI CTAG 2 cut(s) 50, 84
MboII GAAGA 1 cut(s) 196
MluCI AATT 4 cut(s) 104, 141, 196, 218
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 3 cut(s) 58, 161, 192
MseI TTAA 1 cut(s) 59
PceI AGGCCT 1 cut(s) 150
PflFI GACNNNGTC 1 cut(s) 124
PspPI GGNCC 1 cut(s) 67
PstNI CAGNNNCTG 1 cut(s) 172
PsyI GACNNNGTC 1 cut(s) 124
SaqAI TTAA 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 67
SetI ASST 1 cut(s) 98
SgeI CNNG 8 cut(s) 32, 43, 50, 62, 89, 96, 130, 197
SinI GGWCC 1 cut(s) 67
Sse9I AATT 4 cut(s) 104, 141, 196, 218
SseBI AGGCCT 1 cut(s) 150
SsiI CCGC 1 cut(s) 70
SspI AATATT 1 cut(s) 57
SspMI CTAG 2 cut(s) 50, 84
StuI AGGCCT 1 cut(s) 150
StyI CCWWGG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 168
TasI AATT 4 cut(s) 104, 141, 196, 218
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 196
Tth111I GACNNNGTC 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 67
XapI RAATTY 1 cut(s) 104
XmaJI CCTAGG 1 cut(s) 83
XspI CTAG 2 cut(s) 50, 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.