Rw3G010780

Protein transport protein yos1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0001813
Physical Location & Seq
Forward (+)
10394335 .. 10394568
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G010780.1

Sequence Viewer

Length: 234 bp
ATGGGTTTATGGACTTTGATTCAAGGCATGTTGCTATTTGCAAACGGGTTGGCGATTCTGAACGAGGATCGGTTTCTTGCTCCTAGAGGTTGGACCATGTTAGAAGTTCAAAGAGGGAATCGAAGTACGATGAAGGGGCAGCTTATAGGACTTATATATGCGTGCCAGTACTTCAGAATTATGCTCGTTTTCTTCAACTTCATAACTATTATTCTCAAGCTTATATATGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yos1

Protein Analysis

77

Amino Acids

8.92

Weight (kDa)

9.86

Isoelectric Point (pI)

19.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yos1 PF08571 3 - 77 9.6e-23 Yos1-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 75
AcuI CTGAAG 1 cut(s) 157
AfaI GTAC 2 cut(s) 127, 170
AgsI TTSAA 3 cut(s) 23, 110, 196
AluBI AGCT 2 cut(s) 142, 220
AluI AGCT 2 cut(s) 142, 220
AlwI GGATC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 139
AspS9I GGNCC 1 cut(s) 93
AvaII GGWCC 1 cut(s) 93
BbvI GCAGC 1 cut(s) 151
BfaI CTAG 1 cut(s) 84
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BmcAI AGTACT 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 166
BseNI ACTGG 1 cut(s) 166
BseXI GCAGC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 67
BspPI GGATC 1 cut(s) 75
BsrI ACTGG 1 cut(s) 166
BssMI GATC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 163
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstNSI RCATGY 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 163
Cfr13I GGNCC 1 cut(s) 93
Csp6I GTAC 2 cut(s) 126, 169
CviAII CATG 2 cut(s) 28, 97
CviJI RGCY 2 cut(s) 142, 220
CviKI_1 RGCY 2 cut(s) 142, 220
CviQI GTAC 2 cut(s) 126, 169
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 93
Eco57I CTGAAG 1 cut(s) 157
FaeI CATG 2 cut(s) 31, 100
FatI CATG 2 cut(s) 27, 96
Fnu4HI GCNGC 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 1 cut(s) 84
GluI GCNGC 1 cut(s) 140
Hin1II CATG 2 cut(s) 31, 100
HindIII AAGCTT 1 cut(s) 218
HinfI GANTC 3 cut(s) 19, 55, 118
Hpy188I TCNGA 2 cut(s) 60, 176
HpyAV CCTTC 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 41
Hsp92II CATG 2 cut(s) 31, 100
Kzo9I GATC 1 cut(s) 67
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 1 cut(s) 179
Lsp1109I GCAGC 1 cut(s) 151
MaeI CTAG 1 cut(s) 84
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 184
MluCI AATT 1 cut(s) 177
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 3 cut(s) 58, 80, 107
NdeII GATC 1 cut(s) 67
NlaIII CATG 2 cut(s) 31, 100
NspI RCATGY 1 cut(s) 31
PfeI GAWTC 3 cut(s) 19, 55, 118
PkrI GCNGC 1 cut(s) 141
PspPI GGNCC 1 cut(s) 93
RsaI GTAC 2 cut(s) 127, 170
RsaNI GTAC 2 cut(s) 126, 169
SatI GCNGC 1 cut(s) 140
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 93
ScaI AGTACT 1 cut(s) 170
SetI ASST 3 cut(s) 91, 144, 222
SinI GGWCC 1 cut(s) 93
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 1 cut(s) 177
SspMI CTAG 1 cut(s) 84
TaqI TCGA 1 cut(s) 121
TasI AATT 1 cut(s) 177
TatI WGTACW 1 cut(s) 168
TfiI GAWTC 3 cut(s) 19, 55, 118
TseI GCWGC 1 cut(s) 139
TspDTI ATGAA 2 cut(s) 146, 190
VpaK11BI GGWCC 1 cut(s) 93
XceI RCATGY 1 cut(s) 31
XspI CTAG 1 cut(s) 84
ZrmI AGTACT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.