Prupe.2G244600_v2.0.a1

Immediate early response 3-interacting protein 1-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
26236050 .. 26238463
2414 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G244600.3

Sequence Viewer

Length: 234 bp
ATGGGTTTGATGACACTACTTGAAGGCTTTCTGCTTCTTGCAAATGCACTAGCAATATTAAATGAGGACCGCTTCCTTGCGCCTAGAGGATGGAGCCTCGCAGAATTCTCAGTGGGCAGGACAAAGTCAGTCAAGGGACAGATTATAGGTCTCATTTACGCAACACAGTACTTGAGAGTTCCTCTCGTACTACTCAATACCGTCTGCATTGTTCTAAAATTGATATCTGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.42

Weight (kDa)

9.51

Isoelectric Point (pI)

14.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 104
AfaI GTAC 2 cut(s) 170, 189
AgsI TTSAA 1 cut(s) 23
Alw26I GTCTC 1 cut(s) 155
ApoI RAATTY 1 cut(s) 104
Asp700I GAANNNNTTC 1 cut(s) 27
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 67
AvaII GGWCC 1 cut(s) 67
BccI CCATC 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 2 cut(s) 50, 84
BmcAI AGTACT 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 95
BplI GAGNNNNNCTC 4 cut(s) 166, 198, 168, 200
BpuEI CTTGAG 1 cut(s) 193
BsaI GGTCTC 1 cut(s) 155
BseGI GGATG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 123
BslFI GGGAC 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 155
BsmFI GGGAC 1 cut(s) 150
Bso31I GGTCTC 1 cut(s) 155
BspACI CCGC 1 cut(s) 70
BspCNI CTCAG 1 cut(s) 122
BspLI GGNNCC 1 cut(s) 95
BspTNI GGTCTC 1 cut(s) 155
Bst4CI ACNGT 2 cut(s) 168, 202
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 95
BstHHI GCGC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 95
BtsIMutI CAGTG 1 cut(s) 117
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 67
Csp6I GTAC 2 cut(s) 169, 188
CviJI RGCY 2 cut(s) 27, 96
CviKI_1 RGCY 2 cut(s) 27, 96
CviQI GTAC 2 cut(s) 169, 188
DdeI CTNAG 1 cut(s) 109
Eco31I GGTCTC 1 cut(s) 155
Eco32I GATATC 1 cut(s) 225
Eco47I GGWCC 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 104
EcoRV GATATC 1 cut(s) 225
FaiI YATR 1 cut(s) 146
FaqI GGGAC 1 cut(s) 150
FokI GGATG 1 cut(s) 102
FspBI CTAG 2 cut(s) 50, 84
GlaI GCGC 1 cut(s) 81
HhaI GCGC 1 cut(s) 82
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 2 cut(s) 168, 202
HpyCH4V TGCA 3 cut(s) 41, 47, 207
HpyF3I CTNAG 1 cut(s) 109
HspAI GCGC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 2 cut(s) 103, 213
MaeI CTAG 2 cut(s) 50, 84
MluCI AATT 2 cut(s) 104, 218
MnlI CCTC 4 cut(s) 58, 80, 107, 192
MroXI GAANNNNTTC 1 cut(s) 27
MseI TTAA 1 cut(s) 59
NlaIV GGNNCC 1 cut(s) 95
PdmI GAANNNNTTC 1 cut(s) 27
PflFI GACNNNGTC 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 67
PsyI GACNNNGTC 1 cut(s) 124
RsaI GTAC 2 cut(s) 170, 189
RsaNI GTAC 2 cut(s) 169, 188
SaqAI TTAA 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 67
ScaI AGTACT 1 cut(s) 170
SetI ASST 1 cut(s) 151
SinI GGWCC 1 cut(s) 67
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 2 cut(s) 104, 218
SsiI CCGC 1 cut(s) 70
SspI AATATT 1 cut(s) 57
SspMI CTAG 2 cut(s) 50, 84
TaaI ACNGT 2 cut(s) 168, 202
TasI AATT 2 cut(s) 104, 218
TatI WGTACW 1 cut(s) 168
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TscAI CASTG 1 cut(s) 117
TspRI CASTG 1 cut(s) 117
Tth111I GACNNNGTC 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 67
XapI RAATTY 1 cut(s) 104
XmnI GAANNNNTTC 1 cut(s) 27
XspI CTAG 2 cut(s) 50, 84
ZrmI AGTACT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.