AT4G37290

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Reverse (-)
17549607 .. 17550257
651 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G37290.1

Sequence Viewer

Length: 255 bp
ATGATGATGAACAAAAACGTTCTGAGTTCGATTCTGTTCTTCATGTTGATTGGTTCGGTTCTTGTCGAGAGTCGTCCGCTTGGTCTAACAAAGACCGAGGAGAAGTTCGTGGCTAGTTTATTCGATGGCTTATCACTTGGTTCGATCAAAGACTCAGGTCCAAGTCCAGGCGAGGGTCATAAGGTCGTGGACAGGAAGGATACGTTTCGATTTGTTAAGCACTCAGGTCCAAGCCCAAGCGGACCGGGCCACTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.03

Weight (kDa)

9.22

Isoelectric Point (pI)

47.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 77, 240
AclI AACGTT 1 cut(s) 18
AfiI CCNNNNNNNGG 2 cut(s) 167, 173
AjnI CCWGG 1 cut(s) 166
AoxI GGCC 1 cut(s) 247
AspS9I GGNCC 4 cut(s) 158, 227, 242, 247
AsuC2I CCSGG 1 cut(s) 246
AvaII GGWCC 3 cut(s) 158, 227, 242
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 168
BciVI GTATCC 1 cut(s) 193
BcnI CCSGG 1 cut(s) 246
BfaI CTAG 1 cut(s) 114
BfuI GTATCC 1 cut(s) 193
Bme1390I CCNGG 2 cut(s) 168, 246
Bme18I GGWCC 3 cut(s) 158, 227, 242
BmgT120I GGNCC 4 cut(s) 158, 227, 242, 247
BmrFI CCNGG 2 cut(s) 168, 246
BoxI GACNNNNGTC 1 cut(s) 156
BpuMI CCSGG 1 cut(s) 246
BsaJI CCNNGG 1 cut(s) 96
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 173
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 96
BseLI CCNNNNNNNGG 2 cut(s) 167, 173
BseMII CTCAG 3 cut(s) 14, 168, 237
BseRI GAGGAG 1 cut(s) 113
BshFI GGCC 1 cut(s) 249
BsiSI CCGG 1 cut(s) 245
BslI CCNNNNNNNGG 2 cut(s) 167, 173
BsnI GGCC 1 cut(s) 249
Bsp143I GATC 1 cut(s) 144
BspACI CCGC 2 cut(s) 77, 240
BspANI GGCC 1 cut(s) 249
BspCNI CTCAG 3 cut(s) 15, 167, 236
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 1 cut(s) 144
Bst2UI CCWGG 1 cut(s) 168
BstDEI CTNAG 3 cut(s) 23, 154, 223
BstKTI GATC 1 cut(s) 147
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 1 cut(s) 246
BstNI CCWGG 1 cut(s) 168
BstPAI GACNNNNGTC 1 cut(s) 156
BstSCI CCNGG 2 cut(s) 166, 244
BsuI GTATCC 1 cut(s) 193
BsuRI GGCC 1 cut(s) 249
Cfr13I GGNCC 4 cut(s) 158, 227, 242, 247
CpoI CGGWCCG 1 cut(s) 242
CspI CGGWCCG 1 cut(s) 242
CviAII CATG 1 cut(s) 43
CviJI RGCY 4 cut(s) 113, 129, 234, 249
CviKI_1 RGCY 4 cut(s) 113, 129, 234, 249
DdeI CTNAG 3 cut(s) 23, 154, 223
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
Eco47I GGWCC 3 cut(s) 158, 227, 242
EcoRII CCWGG 1 cut(s) 166
FaeI CATG 1 cut(s) 46
FaiI YATR 2 cut(s) 44, 180
FatI CATG 1 cut(s) 42
FspBI CTAG 1 cut(s) 114
HaeIII GGCC 1 cut(s) 249
HapII CCGG 1 cut(s) 245
Hin1II CATG 1 cut(s) 46
HinfI GANTC 3 cut(s) 31, 70, 152
HpaII CCGG 1 cut(s) 245
Hpy166II GTNNAC 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 190
HpyCH4IV ACGT 2 cut(s) 18, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 246
HpyF3I CTNAG 3 cut(s) 23, 154, 223
HpySE526I ACGT 2 cut(s) 18, 203
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 5 cut(s) 141, 153, 178, 180, 210
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 18, 203
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 1 cut(s) 31
MlyI GAGTC 2 cut(s) 79, 146
MnlI CCTC 2 cut(s) 91, 166
MseI TTAA 1 cut(s) 216
MspI CCGG 1 cut(s) 245
MspR9I CCNGG 2 cut(s) 168, 246
MvaI CCWGG 1 cut(s) 168
MwoI GCNNNNNNNGC 1 cut(s) 246
NciI CCSGG 1 cut(s) 246
NdeII GATC 1 cut(s) 144
NlaIII CATG 1 cut(s) 46
PfeI GAWTC 1 cut(s) 31
PleI GAGTC 2 cut(s) 78, 146
PpsI GAGTC 2 cut(s) 78, 146
PshAI GACNNNNGTC 1 cut(s) 156
Psp1406I AACGTT 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspPI GGNCC 4 cut(s) 158, 227, 242, 247
Rsr2I CGGWCCG 1 cut(s) 242
RsrII CGGWCCG 1 cut(s) 242
SaqAI TTAA 1 cut(s) 216
Sau3AI GATC 1 cut(s) 144
Sau96I GGNCC 4 cut(s) 158, 227, 242, 247
SchI GAGTC 2 cut(s) 79, 146
ScrFI CCNGG 2 cut(s) 168, 246
SetI ASST 5 cut(s) 21, 160, 186, 206, 229
SinI GGWCC 3 cut(s) 158, 227, 242
SsiI CCGC 2 cut(s) 77, 240
SspMI CTAG 1 cut(s) 114
StyD4I CCNGG 2 cut(s) 166, 244
TaiI ACGT 2 cut(s) 21, 206
TaqI TCGA 5 cut(s) 29, 66, 123, 143, 208
TaqII GACCGA 1 cut(s) 110
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TspDTI ATGAA 2 cut(s) 23, 31
VpaK11BI GGWCC 3 cut(s) 158, 227, 242
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.