Prupe.8G135500_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0002124
Physical Location & Seq
Forward (+)
15598272 .. 15599191
920 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G135500.1

Sequence Viewer

Length: 264 bp
ATGGCTAGAGCTCTCAAGTCTATTGCCCTCTTGTTTATTCTTCTTCTTGCTTCTCTCCTCTTAAGCTCCAAGCTTTCCCCAACAGAAGCTCGACCGCTGAAGCCATCACGCAATGGTGTTAGTAGAGAGAATGAGGGCTTCTTCAACCAAGTGGATGGTTCAGGACCAAGCGACCCTGGTGTTGGACACAGATCTGTCAGCGTTCAAACTGGTCTAGCAAGTGTCAAGAACTCTGGCCCTGGCCCTGGTGAAGGCCATCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.0

Weight (kDa)

9.98

Isoelectric Point (pI)

28.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 95
AcuI CTGAAG 1 cut(s) 119
AfiI CCNNNNNNNGG 3 cut(s) 182, 245, 251
AflII CTTAAG 1 cut(s) 61
AgsI TTSAA 2 cut(s) 145, 206
AjnI CCWGG 3 cut(s) 175, 238, 244
AluBI AGCT 4 cut(s) 11, 66, 73, 89
AluI AGCT 4 cut(s) 11, 66, 73, 89
Alw21I GWGCWC 1 cut(s) 13
AoxI GGCC 3 cut(s) 235, 241, 253
AspS9I GGNCC 3 cut(s) 164, 236, 242
AsuHPI GGTGA 1 cut(s) 260
AvaII GGWCC 1 cut(s) 164
BanII GRGCYC 1 cut(s) 13
Bbv12I GWGCWC 1 cut(s) 13
BccI CCATC 2 cut(s) 112, 149
BciT130I CCWGG 3 cut(s) 177, 240, 246
BfaI CTAG 2 cut(s) 6, 215
BfrI CTTAAG 1 cut(s) 61
BglII AGATCT 1 cut(s) 191
Bme1390I CCNGG 3 cut(s) 177, 240, 246
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 3 cut(s) 164, 236, 242
BmrFI CCNGG 3 cut(s) 177, 240, 246
BsaJI CCNNGG 3 cut(s) 175, 238, 244
Bsc4I CCNNNNNNNGG 3 cut(s) 182, 245, 251
Bse1I ACTGG 1 cut(s) 214
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 3 cut(s) 177, 240, 246
BseDI CCNNGG 3 cut(s) 175, 238, 244
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 3 cut(s) 182, 245, 251
BseMI GCAATG 1 cut(s) 118
BseNI ACTGG 1 cut(s) 214
BseRI GAGGAG 1 cut(s) 47
Bsh1285I CGRYCG 1 cut(s) 95
BshFI GGCC 3 cut(s) 237, 243, 255
BsiEI CGRYCG 1 cut(s) 95
BsiHKAI GWGCWC 1 cut(s) 13
BslI CCNNNNNNNGG 3 cut(s) 182, 245, 251
BsnI GGCC 3 cut(s) 237, 243, 255
Bsp1286I GDGCHC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 191
BspACI CCGC 1 cut(s) 95
BspANI GGCC 3 cut(s) 237, 243, 255
BspTI CTTAAG 1 cut(s) 61
BsrDI GCAATG 1 cut(s) 118
BsrI ACTGG 1 cut(s) 214
BssECI CCNNGG 3 cut(s) 175, 238, 244
BssMI GATC 1 cut(s) 191
Bst2UI CCWGG 3 cut(s) 177, 240, 246
BstAFI CTTAAG 1 cut(s) 61
BstENI CCTNNNNNAGG 1 cut(s) 249
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 1 cut(s) 194
BstMBI GATC 1 cut(s) 191
BstMCI CGRYCG 1 cut(s) 95
BstNI CCWGG 3 cut(s) 177, 240, 246
BstSCI CCNGG 3 cut(s) 175, 238, 244
BstX2I RGATCY 1 cut(s) 191
BstXI CCANNNNNNTGG 1 cut(s) 155
BstYI RGATCY 1 cut(s) 191
BsuRI GGCC 3 cut(s) 237, 243, 255
BtsCI GGATG 1 cut(s) 160
Cfr13I GGNCC 3 cut(s) 164, 236, 242
DpnI GATC 1 cut(s) 193
DpnII GATC 1 cut(s) 191
Ecl136II GAGCTC 1 cut(s) 11
Eco24I GRGCYC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 164
Eco53kI GAGCTC 1 cut(s) 11
Eco57I CTGAAG 1 cut(s) 119
EcoICRI GAGCTC 1 cut(s) 11
EcoNI CCTNNNNNAGG 1 cut(s) 249
EcoRII CCWGG 3 cut(s) 175, 238, 244
EcoT38I GRGCYC 1 cut(s) 13
FokI GGATG 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 13
FspBI CTAG 2 cut(s) 6, 215
HaeIII GGCC 3 cut(s) 237, 243, 255
HindIII AAGCTT 1 cut(s) 71
HphI GGTGA 1 cut(s) 260
Hpy188III TCNNGA 2 cut(s) 162, 226
HpyAV CCTTC 1 cut(s) 245
Kzo9I GATC 1 cut(s) 191
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 9 cut(s) 147, 162, 189, 195, 219, 225, 231, 252, 258
MaeI CTAG 2 cut(s) 6, 215
MalI GATC 1 cut(s) 193
MboI GATC 1 cut(s) 191
MboII GAAGA 3 cut(s) 32, 35, 133
MflI RGATCY 1 cut(s) 191
MhlI GDGCHC 1 cut(s) 13
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 3 cut(s) 38, 68, 127
MseI TTAA 1 cut(s) 62
MspA1I CMGCKG 1 cut(s) 97
MspCI CTTAAG 1 cut(s) 61
MspR9I CCNGG 3 cut(s) 177, 240, 246
MvaI CCWGG 3 cut(s) 177, 240, 246
NdeII GATC 1 cut(s) 191
Psp124BI GAGCTC 1 cut(s) 13
Psp6I CCWGG 3 cut(s) 175, 238, 244
PspGI CCWGG 3 cut(s) 175, 238, 244
PspPI GGNCC 3 cut(s) 164, 236, 242
PsuI RGATCY 1 cut(s) 191
SacI GAGCTC 1 cut(s) 13
SaqAI TTAA 1 cut(s) 62
Sau3AI GATC 1 cut(s) 191
Sau96I GGNCC 3 cut(s) 164, 236, 242
ScrFI CCNGG 3 cut(s) 177, 240, 246
SduI GDGCHC 1 cut(s) 13
SetI ASST 4 cut(s) 13, 68, 75, 91
SinI GGWCC 1 cut(s) 164
SmlI CTYRAG 2 cut(s) 14, 61
SmoI CTYRAG 2 cut(s) 14, 61
SsiI CCGC 1 cut(s) 95
SspMI CTAG 2 cut(s) 6, 215
SstI GAGCTC 1 cut(s) 13
StyD4I CCNGG 3 cut(s) 175, 238, 244
TaqI TCGA 1 cut(s) 91
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
Vha464I CTTAAG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 164
XagI CCTNNNNNAGG 1 cut(s) 249
XspI CTAG 2 cut(s) 6, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.