pycom05g08970

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0002124
Physical Location & Seq
Forward (+)
11850561 .. 11850776
216 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g08970.1

Sequence Viewer

Length: 216 bp
ATGTTTGCTCTGGTAGAAGCTCGACCACTTAGCAGTTCATCAAGGCCATCACGCTCTGGTGTCACTAGAGAGATTGAGGGCTTATTCTTCAAGGCAGTGAATACTTCAGGACCGAGCCCTGGTACCGGAGGACACAGATTTGTTAACCTTACAACTCCTCTGGCAATTAATGTCAAGAATTCTGGCCCTAGCCCGCCTGGTCCAGGACATCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.37

Weight (kDa)

11.44

Isoelectric Point (pI)

61.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 122
AccB1I GGYRCC 1 cut(s) 122
AciI CCGC 1 cut(s) 194
AcsI RAATTY 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 90
AfaI GTAC 1 cut(s) 124
AfiI CCNNNNNNNGG 3 cut(s) 119, 125, 203
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 3 cut(s) 118, 196, 202
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AoxI GGCC 2 cut(s) 44, 184
ApoI RAATTY 1 cut(s) 178
AseI ATTAAT 1 cut(s) 168
Asp718I GGTACC 1 cut(s) 122
AspS9I GGNCC 3 cut(s) 110, 185, 200
AvaII GGWCC 2 cut(s) 110, 200
BanI GGYRCC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 119
BccI CCATC 1 cut(s) 55
BciT130I CCWGG 3 cut(s) 120, 198, 204
BfaI CTAG 2 cut(s) 66, 189
Bme1390I CCNGG 3 cut(s) 120, 198, 204
Bme18I GGWCC 2 cut(s) 110, 200
BmgT120I GGNCC 3 cut(s) 110, 185, 200
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 3 cut(s) 120, 198, 204
BsaJI CCNNGG 1 cut(s) 118
BsaWI WCCGGW 1 cut(s) 125
Bsc4I CCNNNNNNNGG 3 cut(s) 119, 125, 203
BseBI CCWGG 3 cut(s) 120, 198, 204
BseDI CCNNGG 1 cut(s) 118
BseLI CCNNNNNNNGG 3 cut(s) 119, 125, 203
BseRI GAGGAG 1 cut(s) 147
BshFI GGCC 2 cut(s) 46, 186
BshNI GGYRCC 1 cut(s) 122
BsiSI CCGG 1 cut(s) 126
BslI CCNNNNNNNGG 3 cut(s) 119, 125, 203
BsnI GGCC 2 cut(s) 46, 186
Bsp1286I GDGCHC 1 cut(s) 119
BspACI CCGC 1 cut(s) 194
BspANI GGCC 2 cut(s) 46, 186
BspLI GGNNCC 1 cut(s) 124
BspT107I GGYRCC 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 118
Bst2UI CCWGG 3 cut(s) 120, 198, 204
BstC8I GCNNGC 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 29
BstENI CCTNNNNNAGG 1 cut(s) 201
BstNI CCWGG 3 cut(s) 120, 198, 204
BstSCI CCNGG 3 cut(s) 118, 196, 202
BsuRI GGCC 2 cut(s) 46, 186
BtsI GCAGTG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 194
Cfr13I GGNCC 3 cut(s) 110, 185, 200
Csp6I GTAC 1 cut(s) 123
CviJI RGCY 6 cut(s) 20, 46, 81, 117, 186, 192
CviKI_1 RGCY 6 cut(s) 20, 46, 81, 117, 186, 192
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 1 cut(s) 29
Eco24I GRGCYC 1 cut(s) 119
Eco47I GGWCC 2 cut(s) 110, 200
Eco57I CTGAAG 1 cut(s) 90
EcoNI CCTNNNNNAGG 1 cut(s) 201
EcoRI GAATTC 1 cut(s) 178
EcoRII CCWGG 3 cut(s) 118, 196, 202
EcoT38I GRGCYC 1 cut(s) 119
FauI CCCGC 1 cut(s) 201
FriOI GRGCYC 1 cut(s) 119
FspBI CTAG 2 cut(s) 66, 189
HaeIII GGCC 2 cut(s) 46, 186
HapII CCGG 1 cut(s) 126
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HpaI GTTAAC 1 cut(s) 145
HpaII CCGG 1 cut(s) 126
Hpy166II GTNNAC 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 108, 175
Hpy8I GTNNAC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 29
KpnI GGTACC 1 cut(s) 126
KspAI GTTAAC 1 cut(s) 145
MaeI CTAG 2 cut(s) 66, 189
MaeIII GTNAC 1 cut(s) 61
MboII GAAGA 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 119
MluCI AATT 2 cut(s) 165, 178
MnlI CCTC 3 cut(s) 70, 122, 168
MseI TTAA 2 cut(s) 144, 168
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 3 cut(s) 120, 198, 204
MvaI CCWGG 3 cut(s) 120, 198, 204
NlaIV GGNNCC 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 61
PfoI TCCNGGA 1 cut(s) 202
PshBI ATTAAT 1 cut(s) 168
Psp6I CCWGG 3 cut(s) 118, 196, 202
PspGI CCWGG 3 cut(s) 118, 196, 202
PspN4I GGNNCC 1 cut(s) 124
PspPI GGNCC 3 cut(s) 110, 185, 200
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SaqAI TTAA 2 cut(s) 144, 168
Sau96I GGNCC 3 cut(s) 110, 185, 200
ScrFI CCNGG 3 cut(s) 120, 198, 204
SduI GDGCHC 1 cut(s) 119
SetI ASST 2 cut(s) 22, 150
SinI GGWCC 2 cut(s) 110, 200
Sse9I AATT 2 cut(s) 165, 178
SsiI CCGC 1 cut(s) 194
SspMI CTAG 2 cut(s) 66, 189
StyD4I CCNGG 3 cut(s) 118, 196, 202
TaqI TCGA 1 cut(s) 22
TaqII GACCGA 1 cut(s) 127
TasI AATT 2 cut(s) 165, 178
Tru1I TTAA 2 cut(s) 144, 168
Tru9I TTAA 2 cut(s) 144, 168
TscAI CASTG 1 cut(s) 102
TseFI GTSAC 1 cut(s) 61
Tsp45I GTSAC 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 27
TspRI CASTG 1 cut(s) 102
VpaK11BI GGWCC 2 cut(s) 110, 200
VspI ATTAAT 1 cut(s) 168
XagI CCTNNNNNAGG 1 cut(s) 201
XapI RAATTY 1 cut(s) 178
XspI CTAG 2 cut(s) 66, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.