RchiOBHm_Chr6g0255001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0002124
Physical Location & Seq
Reverse (-)
9953325 .. 9953792
468 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22874

Sequence Viewer

Length: 291 bp
ATGGCTAGAGGAGTGCTCAAGTCACCGGCCATTCTTGTCTTTCTTCTTACTTCTTTCCTCCTAATTACCCAGCTTTCTTCAGTAGAAGCTCGACCACTGAACACTTCAACATCATCATCACTCAACAGTGTCGTCACTAGAGAAAGTACTGAAGGCTTCTTCAGCGCAGTGCAGAGTAGCAGTACTTCGGGAGCAAGTCGGCTGGGGGCTGGAGGACACAGATTGGTGAACCTTCAAAGGCTAGCAACTGTAAAGAACTCTGGCCCTGGCCCTGGTGAAGGGCATCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

9.9

Weight (kDa)

11.34

Isoelectric Point (pI)

39.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 27
AcuI CTGAAG 3 cut(s) 63, 145, 171
AfaI GTAC 2 cut(s) 148, 184
AfiI CCNNNNNNNGG 2 cut(s) 272, 278
AgsI TTSAA 2 cut(s) 108, 236
AjnI CCWGG 2 cut(s) 265, 271
AluBI AGCT 2 cut(s) 73, 89
AluI AGCT 2 cut(s) 73, 89
Alw21I GWGCWC 1 cut(s) 18
AoxI GGCC 3 cut(s) 27, 262, 268
AspLEI GCGC 1 cut(s) 167
AspS9I GGNCC 2 cut(s) 263, 269
AsuHPI GGTGA 3 cut(s) 15, 238, 287
AsuNHI GCTAGC 1 cut(s) 241
BarI GAAGNNNNNNTAC 2 cut(s) 169, 201
Bbv12I GWGCWC 1 cut(s) 18
BciT130I CCWGG 2 cut(s) 267, 273
BfaI CTAG 3 cut(s) 6, 138, 242
BmcAI AGTACT 2 cut(s) 148, 184
Bme1390I CCNGG 2 cut(s) 267, 273
BmgT120I GGNCC 2 cut(s) 263, 269
BmrFI CCNGG 2 cut(s) 267, 273
BmtI GCTAGC 1 cut(s) 245
BplI GAGNNNNNCTC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 231
BsaJI CCNNGG 2 cut(s) 265, 271
Bsc4I CCNNNNNNNGG 2 cut(s) 272, 278
Bse118I RCCGGY 1 cut(s) 25
BseBI CCWGG 2 cut(s) 267, 273
BseDI CCNNGG 2 cut(s) 265, 271
BseGI GGATG 1 cut(s) 283
BseLI CCNNNNNNNGG 2 cut(s) 272, 278
BseRI GAGGAG 1 cut(s) 24
BseYI CCCAGC 2 cut(s) 69, 202
BsgI GTGCAG 1 cut(s) 191
BshFI GGCC 3 cut(s) 29, 264, 270
BsiHKAI GWGCWC 1 cut(s) 18
BsiSI CCGG 1 cut(s) 26
BslI CCNNNNNNNGG 2 cut(s) 272, 278
BsnI GGCC 3 cut(s) 29, 264, 270
Bsp1286I GDGCHC 1 cut(s) 18
BspANI GGCC 3 cut(s) 29, 264, 270
BspOI GCTAGC 1 cut(s) 245
BsrFI RCCGGY 1 cut(s) 25
BssAI RCCGGY 1 cut(s) 25
BssECI CCNNGG 2 cut(s) 265, 271
Bst2UI CCWGG 2 cut(s) 267, 273
Bst4CI ACNGT 2 cut(s) 128, 250
BstC8I GCNNGC 1 cut(s) 243
BstENI CCTNNNNNAGG 1 cut(s) 276
BstF5I GGATG 1 cut(s) 283
BstHHI GCGC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNI CCWGG 2 cut(s) 267, 273
BstSCI CCNGG 2 cut(s) 265, 271
BsuRI GGCC 3 cut(s) 29, 264, 270
BtsCI GGATG 1 cut(s) 283
BtsI GCAGTG 1 cut(s) 174
BtsIMutI CAGTG 3 cut(s) 95, 133, 174
Cac8I GCNNGC 1 cut(s) 243
CfoI GCGC 1 cut(s) 167
Cfr10I RCCGGY 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 263, 269
Csp6I GTAC 2 cut(s) 147, 183
CviQI GTAC 2 cut(s) 147, 183
EaeI YGGCCR 1 cut(s) 27
Eco57I CTGAAG 3 cut(s) 63, 145, 171
EcoNI CCTNNNNNAGG 1 cut(s) 276
EcoRII CCWGG 2 cut(s) 265, 271
FokI GGATG 1 cut(s) 270
FspBI CTAG 3 cut(s) 6, 138, 242
GlaI GCGC 1 cut(s) 166
GsaI CCCAGC 2 cut(s) 73, 206
GsuI CTGGAG 1 cut(s) 231
HaeIII GGCC 3 cut(s) 29, 264, 270
HapII CCGG 1 cut(s) 26
HhaI GCGC 1 cut(s) 167
Hin6I GCGC 1 cut(s) 165
HinP1I GCGC 1 cut(s) 165
HpaII CCGG 1 cut(s) 26
HphI GGTGA 3 cut(s) 15, 238, 287
Hpy166II GTNNAC 1 cut(s) 229
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 229
HpyAV CCTTC 3 cut(s) 146, 242, 272
HpyCH4III ACNGT 2 cut(s) 128, 250
HpyCH4V TGCA 1 cut(s) 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HspAI GCGC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 191
LpnPI CCDG 9 cut(s) 39, 83, 188, 195, 246, 252, 258, 279, 285
MaeI CTAG 3 cut(s) 6, 138, 242
MaeIII GTNAC 2 cut(s) 21, 133
MboII GAAGA 3 cut(s) 35, 69, 151
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 1 cut(s) 63
MnlI CCTC 2 cut(s) 68, 206
MspI CCGG 1 cut(s) 26
MspR9I CCNGG 2 cut(s) 267, 273
MvaI CCWGG 2 cut(s) 267, 273
MwoI GCNNNNNNNGC 1 cut(s) 162
NheI GCTAGC 1 cut(s) 241
NmuCI GTSAC 2 cut(s) 21, 133
Psp6I CCWGG 2 cut(s) 265, 271
PspFI CCCAGC 2 cut(s) 69, 202
PspGI CCWGG 2 cut(s) 265, 271
PspPI GGNCC 2 cut(s) 263, 269
RsaI GTAC 2 cut(s) 148, 184
RsaNI GTAC 2 cut(s) 147, 183
Sau96I GGNCC 2 cut(s) 263, 269
ScaI AGTACT 2 cut(s) 148, 184
ScrFI CCNGG 2 cut(s) 267, 273
SduI GDGCHC 1 cut(s) 18
SetI ASST 3 cut(s) 75, 91, 234
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 1 cut(s) 63
SspMI CTAG 3 cut(s) 6, 138, 242
StyD4I CCNGG 2 cut(s) 265, 271
TaaI ACNGT 2 cut(s) 128, 250
TaqI TCGA 1 cut(s) 91
TasI AATT 1 cut(s) 63
TatI WGTACW 2 cut(s) 146, 182
TscAI CASTG 3 cut(s) 102, 133, 174
TseFI GTSAC 2 cut(s) 21, 133
Tsp45I GTSAC 2 cut(s) 21, 133
TspRI CASTG 3 cut(s) 102, 133, 174
XagI CCTNNNNNAGG 1 cut(s) 276
XspI CTAG 3 cut(s) 6, 138, 242
ZrmI AGTACT 2 cut(s) 148, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.