Rh6CG065300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
6472756 .. 6473512
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG065300.1

Sequence Viewer

Length: 291 bp
ATGGCTAGAGGAGTGCTCAAGTCACTGGCCATTCTTGTCACTCTTCTTGCTTCTTTCCTCCTAATTACCCAGCTTTCTTCAGTAGAAGCTCGACCACTGAACACTTCAACATCATCATCACGCAACAGTGTCGTCACTAGAGAAAGTACTGAAGGCTTCTTCAGCGCAGTGCAGAGTAGCAGTACTTCGGGACCAAGTCGGCTGGGGGCTGGAGGACACAGATTGGTGAACCTTCAAAGGCTAGCAACTGTAAAGAACTCTGGCCCTGGCCCTGGTCAAGGGCATCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

9.94

Weight (kDa)

11.88

Isoelectric Point (pI)

39.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 27
AcuI CTGAAG 3 cut(s) 63, 145, 171
AfaI GTAC 2 cut(s) 148, 184
AfiI CCNNNNNNNGG 2 cut(s) 272, 278
AgsI TTSAA 2 cut(s) 108, 236
AjnI CCWGG 2 cut(s) 265, 271
AluBI AGCT 2 cut(s) 73, 89
AluI AGCT 2 cut(s) 73, 89
Alw21I GWGCWC 1 cut(s) 18
AoxI GGCC 3 cut(s) 27, 262, 268
AspLEI GCGC 1 cut(s) 167
AspS9I GGNCC 3 cut(s) 191, 263, 269
AsuHPI GGTGA 1 cut(s) 238
AsuNHI GCTAGC 1 cut(s) 241
AvaII GGWCC 1 cut(s) 191
BalI TGGCCA 1 cut(s) 29
BarI GAAGNNNNNNTAC 2 cut(s) 169, 201
Bbv12I GWGCWC 1 cut(s) 18
BcgI CGANNNNNNTGC 2 cut(s) 112, 146
BciT130I CCWGG 2 cut(s) 267, 273
BfaI CTAG 3 cut(s) 6, 138, 242
BmcAI AGTACT 2 cut(s) 148, 184
Bme1390I CCNGG 2 cut(s) 267, 273
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 3 cut(s) 191, 263, 269
BmiI GGNNCC 1 cut(s) 192
BmrFI CCNGG 2 cut(s) 267, 273
BmtI GCTAGC 1 cut(s) 245
BplI GAGNNNNNCTC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 231
BsaJI CCNNGG 2 cut(s) 265, 271
Bsc4I CCNNNNNNNGG 2 cut(s) 272, 278
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 2 cut(s) 267, 273
BseDI CCNNGG 2 cut(s) 265, 271
BseLI CCNNNNNNNGG 2 cut(s) 272, 278
BseNI ACTGG 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 24
BseYI CCCAGC 2 cut(s) 69, 202
BsgI GTGCAG 1 cut(s) 191
BshFI GGCC 3 cut(s) 29, 264, 270
BsiHKAI GWGCWC 1 cut(s) 18
BslFI GGGAC 1 cut(s) 204
BslI CCNNNNNNNGG 2 cut(s) 272, 278
BsmFI GGGAC 1 cut(s) 204
BsnI GGCC 3 cut(s) 29, 264, 270
Bsp1286I GDGCHC 1 cut(s) 18
BspANI GGCC 3 cut(s) 29, 264, 270
BspLI GGNNCC 1 cut(s) 192
BspOI GCTAGC 1 cut(s) 245
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 265, 271
Bst2UI CCWGG 2 cut(s) 267, 273
Bst4CI ACNGT 2 cut(s) 128, 250
Bst6I CTCTTC 1 cut(s) 48
BstC8I GCNNGC 1 cut(s) 243
BstENI CCTNNNNNAGG 1 cut(s) 276
BstHHI GCGC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNI CCWGG 2 cut(s) 267, 273
BstSCI CCNGG 2 cut(s) 265, 271
BsuRI GGCC 3 cut(s) 29, 264, 270
BtsI GCAGTG 1 cut(s) 174
BtsIMutI CAGTG 4 cut(s) 23, 95, 133, 174
Cac8I GCNNGC 1 cut(s) 243
CfoI GCGC 1 cut(s) 167
Cfr13I GGNCC 3 cut(s) 191, 263, 269
Csp6I GTAC 2 cut(s) 147, 183
CviQI GTAC 2 cut(s) 147, 183
EaeI YGGCCR 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco47I GGWCC 1 cut(s) 191
Eco57I CTGAAG 3 cut(s) 63, 145, 171
EcoNI CCTNNNNNAGG 1 cut(s) 276
EcoRII CCWGG 2 cut(s) 265, 271
FaqI GGGAC 1 cut(s) 204
FspBI CTAG 3 cut(s) 6, 138, 242
GlaI GCGC 1 cut(s) 166
GsaI CCCAGC 2 cut(s) 73, 206
GsuI CTGGAG 1 cut(s) 231
HaeIII GGCC 3 cut(s) 29, 264, 270
HhaI GCGC 1 cut(s) 167
Hin6I GCGC 1 cut(s) 165
HinP1I GCGC 1 cut(s) 165
HphI GGTGA 1 cut(s) 238
Hpy166II GTNNAC 1 cut(s) 229
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 229
HpyAV CCTTC 2 cut(s) 146, 242
HpyCH4III ACNGT 2 cut(s) 128, 250
HpyCH4V TGCA 1 cut(s) 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HspAI GCGC 1 cut(s) 165
LpnPI CCDG 9 cut(s) 11, 83, 188, 195, 246, 252, 258, 279, 285
MaeI CTAG 3 cut(s) 6, 138, 242
MaeIII GTNAC 3 cut(s) 21, 37, 133
MboII GAAGA 3 cut(s) 35, 69, 151
MhlI GDGCHC 1 cut(s) 18
MlsI TGGCCA 1 cut(s) 29
MluCI AATT 1 cut(s) 63
MluNI TGGCCA 1 cut(s) 29
MnlI CCTC 2 cut(s) 68, 206
Mox20I TGGCCA 1 cut(s) 29
MscI TGGCCA 1 cut(s) 29
Msp20I TGGCCA 1 cut(s) 29
MspR9I CCNGG 2 cut(s) 267, 273
MvaI CCWGG 2 cut(s) 267, 273
MwoI GCNNNNNNNGC 1 cut(s) 162
NheI GCTAGC 1 cut(s) 241
NlaIV GGNNCC 1 cut(s) 192
NmuCI GTSAC 3 cut(s) 21, 37, 133
PflFI GACNNNGTC 1 cut(s) 195
Psp6I CCWGG 2 cut(s) 265, 271
PspFI CCCAGC 2 cut(s) 69, 202
PspGI CCWGG 2 cut(s) 265, 271
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 3 cut(s) 191, 263, 269
PsyI GACNNNGTC 1 cut(s) 195
RsaI GTAC 2 cut(s) 148, 184
RsaNI GTAC 2 cut(s) 147, 183
Sau96I GGNCC 3 cut(s) 191, 263, 269
ScaI AGTACT 2 cut(s) 148, 184
ScrFI CCNGG 2 cut(s) 267, 273
SduI GDGCHC 1 cut(s) 18
SetI ASST 3 cut(s) 75, 91, 234
SinI GGWCC 1 cut(s) 191
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 1 cut(s) 63
SspMI CTAG 3 cut(s) 6, 138, 242
StyD4I CCNGG 2 cut(s) 265, 271
TaaI ACNGT 2 cut(s) 128, 250
TaqI TCGA 1 cut(s) 91
TasI AATT 1 cut(s) 63
TatI WGTACW 2 cut(s) 146, 182
TscAI CASTG 4 cut(s) 30, 102, 133, 174
TseFI GTSAC 3 cut(s) 21, 37, 133
Tsp45I GTSAC 3 cut(s) 21, 37, 133
TspRI CASTG 4 cut(s) 30, 102, 133, 174
Tth111I GACNNNGTC 1 cut(s) 195
VpaK11BI GGWCC 1 cut(s) 191
XagI CCTNNNNNAGG 1 cut(s) 276
XspI CTAG 3 cut(s) 6, 138, 242
ZrmI AGTACT 2 cut(s) 148, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.