FvH4_3g13691
HSP70 Family

heat shock

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
8226610 .. 8227193
584 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g13691.t1

Sequence Viewer

Length: 318 bp
ATGTCATCATACTGCTTTATGAACTTTGCTACAGCATATAAGAGTTGCAAAGTCCTTTCAAAAAAGAGTTACAAAGTATTGACGAGGACAGTTGCAGGACTGTATTTATGCTTTGGAGAATACAATCATGCTTACAATATGAGGAATACTATCAAGGATGAAAAGATTGCTGGGAATTTGGAGCCTTCAGATAAGCAAAGGATAGTGAAGGCCGTGGGTGCTGGTGCTGGAGGAGGTGTGGCGCCTATGGGTGATGACATGCCTGGTGCTCATTCTAATGGTTCTGCAACCGTACCTGGCCCAAATATTGAAAAGTAA

Protein Analysis

106

Amino Acids

11.2

Weight (kDa)

9.2

Isoelectric Point (pI)

28.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 241
AcsI RAATTY 1 cut(s) 175
AcuI CTGAAG 1 cut(s) 171
AcyI GRCGYC 1 cut(s) 242
AfaI GTAC 1 cut(s) 294
AgsI TTSAA 2 cut(s) 60, 311
AjnI CCWGG 2 cut(s) 262, 295
Alw21I GWGCWC 1 cut(s) 271
AoxI GGCC 2 cut(s) 210, 298
ApoI RAATTY 1 cut(s) 175
AspLEI GCGC 1 cut(s) 244
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 1 cut(s) 263
BanI GGYRCC 1 cut(s) 241
Bbv12I GWGCWC 1 cut(s) 271
BceAI ACGGC 1 cut(s) 197
BciT130I CCWGG 2 cut(s) 264, 297
BfmI CTRYAG 1 cut(s) 30
BfoI RGCGCY 1 cut(s) 245
Bme1390I CCNGG 2 cut(s) 264, 297
BmgT120I GGNCC 1 cut(s) 299
BmiI GGNNCC 2 cut(s) 183, 243
BmrFI CCNGG 2 cut(s) 264, 297
BpmI CTGGAG 1 cut(s) 249
BsaHI GRCGYC 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 213
BsaXI ACNNNNNCTCC 2 cut(s) 222, 252
BseBI CCWGG 2 cut(s) 264, 297
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 163
BseRI GAGGAG 1 cut(s) 246
BseYI CCCAGC 1 cut(s) 170
BshFI GGCC 2 cut(s) 212, 300
BshNI GGYRCC 1 cut(s) 241
BsiHKAI GWGCWC 1 cut(s) 271
BsnI GGCC 2 cut(s) 212, 300
Bsp1286I GDGCHC 1 cut(s) 271
BspANI GGCC 2 cut(s) 212, 300
BspLI GGNNCC 2 cut(s) 183, 243
BspT107I GGYRCC 1 cut(s) 241
BssECI CCNNGG 1 cut(s) 213
BssNI GRCGYC 1 cut(s) 242
Bst2UI CCWGG 2 cut(s) 264, 297
Bst4CI ACNGT 3 cut(s) 91, 102, 292
BstACI GRCGYC 1 cut(s) 242
BstDSI CCRYGG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 163
BstH2I RGCGCY 1 cut(s) 245
BstHHI GCGC 1 cut(s) 244
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstNI CCWGG 2 cut(s) 264, 297
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 2 cut(s) 262, 295
BstSFI CTRYAG 1 cut(s) 30
BsuRI GGCC 2 cut(s) 212, 300
BtgI CCRYGG 1 cut(s) 213
BtsCI GGATG 1 cut(s) 163
CfoI GCGC 1 cut(s) 244
Cfr13I GGNCC 1 cut(s) 299
Csp6I GTAC 1 cut(s) 293
CviAII CATG 2 cut(s) 128, 259
CviJI RGCY 3 cut(s) 184, 212, 300
CviKI_1 RGCY 3 cut(s) 184, 212, 300
CviQI GTAC 1 cut(s) 293
DinI GGCGCC 1 cut(s) 243
Eco57I CTGAAG 1 cut(s) 171
EcoRII CCWGG 2 cut(s) 262, 295
EgeI GGCGCC 1 cut(s) 243
EheI GGCGCC 1 cut(s) 243
FaeI CATG 2 cut(s) 131, 262
FaiI YATR 9 cut(s) 10, 20, 37, 39, 109, 129, 140, 248, 260
FatI CATG 2 cut(s) 127, 258
FokI GGATG 1 cut(s) 170
GlaI GCGC 1 cut(s) 243
GsaI CCCAGC 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 249
HaeII RGCGCY 1 cut(s) 245
HaeIII GGCC 2 cut(s) 212, 300
HhaI GCGC 1 cut(s) 244
Hin1I GRCGYC 1 cut(s) 242
Hin1II CATG 2 cut(s) 131, 262
Hin6I GCGC 1 cut(s) 242
HinP1I GCGC 1 cut(s) 242
HphI GGTGA 1 cut(s) 263
Hpy188I TCNGA 1 cut(s) 190
HpyAV CCTTC 2 cut(s) 195, 202
HpyCH4III ACNGT 3 cut(s) 91, 102, 292
HpyCH4V TGCA 3 cut(s) 48, 95, 287
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
Hsp92I GRCGYC 1 cut(s) 242
Hsp92II CATG 2 cut(s) 131, 262
HspAI GCGC 1 cut(s) 242
KasI GGCGCC 1 cut(s) 241
LmnI GCTCC 1 cut(s) 181
LpnPI CCDG 8 cut(s) 81, 156, 207, 213, 249, 276, 282, 309
MaeIII GTNAC 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 271
MluCI AATT 1 cut(s) 175
Mly113I GGCGCC 1 cut(s) 242
MnlI CCTC 4 cut(s) 78, 135, 224, 227
MslI CAYNNNNRTG 1 cut(s) 276
MspR9I CCNGG 2 cut(s) 264, 297
MvaI CCWGG 2 cut(s) 264, 297
MwoI GCNNNNNNNGC 1 cut(s) 218
NarI GGCGCC 1 cut(s) 242
NlaIII CATG 2 cut(s) 131, 262
NlaIV GGNNCC 2 cut(s) 183, 243
NspI RCATGY 1 cut(s) 262
PluTI GGCGCC 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 262, 295
PspFI CCCAGC 1 cut(s) 170
PspGI CCWGG 2 cut(s) 262, 295
PspN4I GGNNCC 2 cut(s) 183, 243
PspPI GGNCC 1 cut(s) 299
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
RseI CAYNNNNRTG 1 cut(s) 276
Sau96I GGNCC 1 cut(s) 299
ScrFI CCNGG 2 cut(s) 264, 297
SduI GDGCHC 1 cut(s) 271
SetI ASST 2 cut(s) 238, 298
SfcI CTRYAG 1 cut(s) 30
SfoI GGCGCC 1 cut(s) 243
SmiMI CAYNNNNRTG 1 cut(s) 276
Sse9I AATT 1 cut(s) 175
SspDI GGCGCC 1 cut(s) 241
SspI AATATT 1 cut(s) 307
StyD4I CCNGG 2 cut(s) 262, 295
TaaI ACNGT 3 cut(s) 91, 102, 292
TasI AATT 1 cut(s) 175
TspDTI ATGAA 2 cut(s) 35, 174
XapI RAATTY 1 cut(s) 175
XceI RCATGY 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.