FvH4_5g38882
HSP70 Family

Belongs to the heat shock protein 70 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0003935
Physical Location & Seq
Reverse (-)
28731035 .. 28731669
635 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g38882.t1

Sequence Viewer

Length: 390 bp
ATGAGTAACACCATCAGAAACATTGCTGCCAAGCTTGACGCAGGGAACAAGAAGAAGATTGGAGATGCAATCGAGCAAGCTTTTCAATGGCTAGATGGCAATCAGCTTGCTAAGGCCGAAGACTATGATGACGAGGTGAAGGAGGTCGAAGGCATCCACACTTCCATCATGGCAAAGATGTACGAAGGCGACGCTGCTCCTGACATGGGTGGTTGCACAGCTGAAGATGTTCCTCCAACAAAAAGGGAAATAAAATATGCAGTTGAGTTGTTTAGGCATATGCAGAGAAGGATGTTATCTCTTGGACCTCCATGGTCAAAAGCTATGCACAAAAGGGCTCTAATAAAACCACTTAAAGTTTTCTGTGAGATGATGGATGCAGGGATCTAA

Protein Analysis

130

Amino Acids

14.47

Weight (kDa)

6.3

Isoelectric Point (pI)

55.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 243
AfaI GTAC 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 206
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 5 cut(s) 34, 80, 106, 221, 323
AluI AGCT 5 cut(s) 34, 80, 106, 221, 323
AoxI GGCC 1 cut(s) 114
ApeKI GCWGC 2 cut(s) 26, 194
Asp700I GAANNNNTTC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 305
AsuHPI GGTGA 1 cut(s) 148
AvaII GGWCC 1 cut(s) 305
BanII GRGCYC 1 cut(s) 340
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 2 cut(s) 13, 181
BccI CCATC 4 cut(s) 20, 89, 173, 367
BfaI CTAG 1 cut(s) 92
BisI GCNGC 2 cut(s) 27, 195
BlsI GCNGC 2 cut(s) 28, 196
Bme18I GGWCC 1 cut(s) 305
BmgT120I GGNCC 1 cut(s) 305
BmsI GCATC 3 cut(s) 55, 162, 367
BpiI GAAGAC 1 cut(s) 126
Bpu10I CCTNAGC 1 cut(s) 111
BsaBI GATNNNNATC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 311
Bsc4I CCNNNNNNNGG 1 cut(s) 206
Bse3DI GCAATG 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 311
BseGI GGATG 3 cut(s) 153, 297, 382
BseJI GATNNNNATC 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 206
BseMI GCAATG 1 cut(s) 21
BseXI GCAGC 2 cut(s) 13, 181
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 206
BsnI GGCC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 340
Bsp143I GATC 1 cut(s) 384
Bsp19I CCATGG 1 cut(s) 311
BspANI GGCC 1 cut(s) 116
BsrDI GCAATG 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 311
BssMI GATC 1 cut(s) 384
BssT1I CCWWGG 1 cut(s) 311
BstC8I GCNNGC 2 cut(s) 78, 108
BstDEI CTNAG 1 cut(s) 111
BstDSI CCRYGG 1 cut(s) 311
BstF5I GGATG 3 cut(s) 153, 297, 382
BstKTI GATC 1 cut(s) 387
BstMBI GATC 1 cut(s) 384
BstV1I GCAGC 2 cut(s) 13, 181
BstV2I GAAGAC 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 384
BstYI RGATCY 1 cut(s) 384
BsuRI GGCC 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 311
BtsCI GGATG 3 cut(s) 153, 297, 382
Cac8I GCNNGC 2 cut(s) 78, 108
Cfr13I GGNCC 1 cut(s) 305
CseI GACGC 2 cut(s) 47, 200
Csp6I GTAC 1 cut(s) 181
CviAII CATG 3 cut(s) 169, 205, 312
CviJI RGCY 8 cut(s) 34, 80, 91, 106, 116, 221, 323, 338
CviKI_1 RGCY 8 cut(s) 34, 80, 91, 106, 116, 221, 323, 338
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 386
DpnII GATC 1 cut(s) 384
Eco130I CCWWGG 1 cut(s) 311
Eco24I GRGCYC 1 cut(s) 340
Eco47I GGWCC 1 cut(s) 305
Eco57I CTGAAG 1 cut(s) 243
EcoT14I CCWWGG 1 cut(s) 311
EcoT38I GRGCYC 1 cut(s) 340
ErhI CCWWGG 1 cut(s) 311
FaeI CATG 3 cut(s) 172, 208, 315
FaiI YATR 8 cut(s) 126, 170, 206, 258, 279, 281, 313, 326
FatI CATG 3 cut(s) 168, 204, 311
FauNDI CATATG 1 cut(s) 279
Fnu4HI GCNGC 2 cut(s) 27, 195
FokI GGATG 2 cut(s) 140, 304
FriOI GRGCYC 1 cut(s) 340
Fsp4HI GCNGC 2 cut(s) 27, 195
FspBI CTAG 1 cut(s) 92
GluI GCNGC 2 cut(s) 27, 195
HaeIII GGCC 1 cut(s) 116
HgaI GACGC 2 cut(s) 47, 200
Hin1II CATG 3 cut(s) 172, 208, 315
HindIII AAGCTT 2 cut(s) 32, 78
HphI GGTGA 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 200
Hpy99I CGWCG 1 cut(s) 194
HpyAV CCTTC 4 cut(s) 133, 143, 179, 282
HpyCH4V TGCA 6 cut(s) 68, 216, 260, 283, 328, 380
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 3 cut(s) 172, 208, 315
Kzo9I GATC 1 cut(s) 384
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 3 cut(s) 27, 213, 366
Lsp1109I GCAGC 2 cut(s) 13, 181
LweI GCATC 3 cut(s) 55, 162, 367
MaeI CTAG 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 386
MboI GATC 1 cut(s) 384
MboII GAAGA 4 cut(s) 64, 67, 131, 236
MflI RGATCY 1 cut(s) 384
MhlI GDGCHC 1 cut(s) 340
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 4 cut(s) 127, 136, 243, 318
MroXI GAANNNNTTC 1 cut(s) 228
MseI TTAA 1 cut(s) 354
MspA1I CMGCKG 1 cut(s) 221
NcoI CCATGG 1 cut(s) 311
NdeI CATATG 1 cut(s) 279
NdeII GATC 1 cut(s) 384
NlaIII CATG 3 cut(s) 172, 208, 315
PdmI GAANNNNTTC 1 cut(s) 228
PkrI GCNGC 2 cut(s) 28, 196
PspPI GGNCC 1 cut(s) 305
PsuI RGATCY 1 cut(s) 384
PvuII CAGCTG 1 cut(s) 221
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SaqAI TTAA 1 cut(s) 354
SatI GCNGC 2 cut(s) 27, 195
Sau3AI GATC 1 cut(s) 384
Sau96I GGNCC 1 cut(s) 305
SduI GDGCHC 1 cut(s) 340
SetI ASST 8 cut(s) 36, 82, 108, 138, 147, 223, 310, 325
SfaNI GCATC 3 cut(s) 55, 162, 367
SinI GGWCC 1 cut(s) 305
SspMI CTAG 1 cut(s) 92
StyI CCWWGG 1 cut(s) 311
TaqI TCGA 2 cut(s) 72, 147
Tru1I TTAA 1 cut(s) 354
Tru9I TTAA 1 cut(s) 354
TseI GCWGC 2 cut(s) 26, 194
VpaK11BI GGWCC 1 cut(s) 305
XmnI GAANNNNTTC 1 cut(s) 228
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.