RchiOBHm_Chr7g0201421
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
19018210 .. 19018494
285 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18029

Sequence Viewer

Length: 285 bp
ATGGTAAAGGAGGCAGAGAAGTACAAGTTAGAGGATCGGGAGAAGAAGAAGAAAATGGAGGCTAAGCTTGCATTGAAAGATTATGCATCTAACATGGTGGACACAGTTTCTAACATCCTAAATTTGAACGAAGCAGACAAGACACAAATTGTAGATGCAGTTGAAACAGTAGTCATGTCATGGCTTGATGAGAATGAGAACAAACTTGCTGAATGTGAAAATTATGAGAATGAGATGAGAAAACTTGAAAACCTCTGCAATTCCATGTGGCCTAAGATGAACTAG
Functional Annotation

Protein Analysis

94

Amino Acids

11.05

Weight (kDa)

4.83

Isoelectric Point (pI)

25.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 42
AcsI RAATTY 1 cut(s) 121
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 4 cut(s) 76, 127, 164, 248
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AlwI GGATC 1 cut(s) 42
AoxI GGCC 1 cut(s) 269
ApoI RAATTY 1 cut(s) 121
BfaI CTAG 1 cut(s) 283
BlpI GCTNAGC 1 cut(s) 63
BmsI GCATC 2 cut(s) 95, 145
Bpu1102I GCTNAGC 1 cut(s) 63
BseGI GGATG 1 cut(s) 114
BshFI GGCC 1 cut(s) 271
BsnI GGCC 1 cut(s) 271
Bsp143I GATC 1 cut(s) 34
Bsp1720I GCTNAGC 1 cut(s) 63
BspANI GGCC 1 cut(s) 271
BspPI GGATC 1 cut(s) 42
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 2 cut(s) 106, 169
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 63, 273
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 68
BsuRI GGCC 1 cut(s) 271
BtsCI GGATG 1 cut(s) 114
Cac8I GCNNGC 1 cut(s) 69
Csp6I GTAC 1 cut(s) 22
CviAII CATG 4 cut(s) 94, 175, 180, 265
CviJI RGCY 4 cut(s) 62, 67, 184, 271
CviKI_1 RGCY 4 cut(s) 62, 67, 184, 271
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 2 cut(s) 63, 273
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
EcoT22I ATGCAT 1 cut(s) 88
FaeI CATG 4 cut(s) 97, 178, 183, 268
FaiI YATR 6 cut(s) 84, 95, 176, 181, 225, 266
FatI CATG 4 cut(s) 93, 174, 179, 264
FokI GGATG 1 cut(s) 101
FspBI CTAG 1 cut(s) 283
HaeIII GGCC 1 cut(s) 271
Hin1II CATG 4 cut(s) 97, 178, 183, 268
HindIII AAGCTT 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 100
HpyCH4III ACNGT 2 cut(s) 106, 169
HpyCH4V TGCA 4 cut(s) 71, 86, 158, 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 2 cut(s) 63, 273
Hsp92II CATG 4 cut(s) 97, 178, 183, 268
Kzo9I GATC 1 cut(s) 34
LweI GCATC 2 cut(s) 95, 145
MaeI CTAG 1 cut(s) 283
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 3 cut(s) 55, 58, 61
MluCI AATT 4 cut(s) 121, 147, 220, 259
MnlI CCTC 4 cut(s) 4, 25, 52, 263
Mph1103I ATGCAT 1 cut(s) 88
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 1 cut(s) 34
NlaIII CATG 4 cut(s) 97, 178, 183, 268
NsiI ATGCAT 1 cut(s) 88
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
Sau3AI GATC 1 cut(s) 34
SetI ASST 2 cut(s) 69, 255
SfaNI GCATC 2 cut(s) 95, 145
Sse9I AATT 4 cut(s) 121, 147, 220, 259
SspMI CTAG 1 cut(s) 283
TaaI ACNGT 2 cut(s) 106, 169
TasI AATT 4 cut(s) 121, 147, 220, 259
TatI WGTACW 1 cut(s) 21
XapI RAATTY 1 cut(s) 121
XspI CTAG 1 cut(s) 283
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.