Rmu_sc0000617.1_g000007
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000617.1
Physical Location & Seq
Reverse (-)
51849 .. 52109
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000617.1_g000007.1.cds

Sequence Viewer

Length: 261 bp
atggtcgataaggcagagaagtacatgtgcgatgacgatgattataagaagaaaatggaggctatggttgcattagcaaactatgcaaccaacaagatggacacagttcataatcgctcaaacctcaaccaagaagacaagaaaagaatcgcggatgcggttgaaaaagtcattgagtggcttgatgagaatgagaatcatcttgctgaatgtgaagaatatgaggataagctaagaaagctcgatgacatgaatgaataa
Functional Annotation

Protein Analysis

86

Amino Acids

10.23

Weight (kDa)

4.61

Isoelectric Point (pI)

50.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 45
AccII CGCG 1 cut(s) 152
AciI CCGC 2 cut(s) 152, 158
AfaI GTAC 1 cut(s) 23
AflIII ACRYGT 1 cut(s) 24
AgsI TTSAA 1 cut(s) 164
AluBI AGCT 2 cut(s) 232, 241
AluI AGCT 2 cut(s) 232, 241
BbsI GAAGAC 1 cut(s) 141
BccI CCATC 1 cut(s) 91
BmsI GCATC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 141
BseGI GGATG 1 cut(s) 160
Bsh1236I CGCG 1 cut(s) 152
BspACI CCGC 2 cut(s) 152, 158
BspFNI CGCG 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 106
BstAPI GCANNNNNTGC 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 233
BstF5I GGATG 1 cut(s) 160
BstFNI CGCG 1 cut(s) 152
BstMWI GCNNNNNNNGC 3 cut(s) 68, 83, 238
BstNSI RCATGY 1 cut(s) 28
BstUI CGCG 1 cut(s) 152
BstV2I GAAGAC 1 cut(s) 141
BstXI CCANNNNNNTGG 1 cut(s) 97
BtgZI GCGATG 1 cut(s) 45
BtsCI GGATG 1 cut(s) 160
Csp6I GTAC 1 cut(s) 22
CviAII CATG 2 cut(s) 25, 250
CviJI RGCY 4 cut(s) 62, 181, 232, 241
CviKI_1 RGCY 4 cut(s) 62, 181, 232, 241
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 1 cut(s) 233
FaeI CATG 2 cut(s) 28, 253
FaiI YATR 7 cut(s) 26, 45, 65, 84, 111, 222, 251
FatI CATG 2 cut(s) 24, 249
FokI GGATG 1 cut(s) 167
Hin1II CATG 2 cut(s) 28, 253
HinfI GANTC 2 cut(s) 147, 196
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 71, 86
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 83, 238
HpyF3I CTNAG 1 cut(s) 233
Hsp92II CATG 2 cut(s) 28, 253
LweI GCATC 1 cut(s) 145
MboII GAAGA 3 cut(s) 61, 146, 227
MnlI CCTC 3 cut(s) 52, 134, 217
MvnI CGCG 1 cut(s) 152
MwoI GCNNNNNNNGC 3 cut(s) 68, 83, 238
NlaIII CATG 2 cut(s) 28, 253
NspI RCATGY 1 cut(s) 28
PciI ACATGT 1 cut(s) 24
PfeI GAWTC 2 cut(s) 147, 196
PscI ACATGT 1 cut(s) 24
PsiI TTATAA 1 cut(s) 45
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SetI ASST 3 cut(s) 126, 234, 243
SfaNI GCATC 1 cut(s) 145
SgeI CNNG 8 cut(s) 37, 106, 143, 151, 163, 194, 215, 254
SsiI CCGC 2 cut(s) 152, 158
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 2 cut(s) 6, 243
TatI WGTACW 1 cut(s) 21
TfiI GAWTC 2 cut(s) 147, 196
TspDTI ATGAA 1 cut(s) 98
XceI RCATGY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.