MD17G1225800.v1.1
HSP70 Family

Heat shock 70 kDa

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
27419599 .. 27419844
246 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1225800.v1.1.491

Sequence Viewer

Length: 222 bp
ATGGAGAAGGCCATTGACGAGGCAATCGAGTGGCTAGACCGGAACCAGTTGGCTGAGGTGGAGGAGTTTAAGGATAAGCAAAAGGAGTTGGAGGGATTGTGCAACACGATTATTACCAAAATGTATCAAGGTGCTGGTGGGGATGTGCCAATGGGCGGTGGTGCTCGGATGCCTGGAGGTGGAAACGCTAGCTGTGGTGGTGGATCAGGAGCCGGACCTTAA
Functional Annotation

Protein Analysis

74

Amino Acids

7.54

Weight (kDa)

4.49

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AclWI GGATC 1 cut(s) 211
AfiI CCNNNNNNNGG 2 cut(s) 155, 179
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 192
AluI AGCT 1 cut(s) 192
Alw21I GWGCWC 1 cut(s) 166
AlwI GGATC 1 cut(s) 211
AoxI GGCC 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 215
AsuNHI GCTAGC 1 cut(s) 188
AvaII GGWCC 1 cut(s) 215
Bbv12I GWGCWC 1 cut(s) 166
BbvCI CCTCAGC 1 cut(s) 54
BciT130I CCWGG 1 cut(s) 174
BfaI CTAG 2 cut(s) 35, 189
Bme1390I CCNGG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 2 cut(s) 44, 211
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 1 cut(s) 159
BmtI GCTAGC 1 cut(s) 192
BpmI CTGGAG 1 cut(s) 195
Bpu10I CCTNAGC 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 83, 113
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 179
Bse1I ACTGG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 174
BseGI GGATG 2 cut(s) 148, 174
BseLI CCNNNNNNNGG 2 cut(s) 155, 179
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 46
BseRI GAGGAG 1 cut(s) 77
BshFI GGCC 1 cut(s) 11
BsiHKAI GWGCWC 1 cut(s) 166
BsiSI CCGG 2 cut(s) 40, 213
BslI CCNNNNNNNGG 2 cut(s) 155, 179
BsnI GGCC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 203
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 2 cut(s) 44, 211
BspOI GCTAGC 1 cut(s) 192
BspPI GGATC 1 cut(s) 211
BsrI ACTGG 1 cut(s) 46
BssMI GATC 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 190
BstDEI CTNAG 1 cut(s) 54
BstF5I GGATG 2 cut(s) 148, 174
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BsuRI GGCC 1 cut(s) 11
BtsCI GGATG 2 cut(s) 148, 174
Cac8I GCNNGC 1 cut(s) 190
Cfr13I GGNCC 1 cut(s) 215
CviJI RGCY 5 cut(s) 11, 34, 53, 192, 212
CviKI_1 RGCY 5 cut(s) 11, 34, 53, 192, 212
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
Eco47I GGWCC 1 cut(s) 215
EcoRII CCWGG 1 cut(s) 172
FokI GGATG 2 cut(s) 155, 181
FspBI CTAG 2 cut(s) 35, 189
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 11
HapII CCGG 2 cut(s) 40, 213
HpaII CCGG 2 cut(s) 40, 213
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 207
HpyCH4V TGCA 1 cut(s) 102
HpyF3I CTNAG 1 cut(s) 54
Kzo9I GATC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 209
LpnPI CCDG 6 cut(s) 53, 59, 120, 159, 186, 192
LweI GCATC 1 cut(s) 159
MaeI CTAG 2 cut(s) 35, 189
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MhlI GDGCHC 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 5 cut(s) 13, 49, 55, 85, 170
MseI TTAA 2 cut(s) 69, 220
MspI CCGG 2 cut(s) 40, 213
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NdeII GATC 1 cut(s) 203
NheI GCTAGC 1 cut(s) 188
NlaIV GGNNCC 2 cut(s) 44, 211
PcsI WCGNNNNNNNCGW 1 cut(s) 24
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspN4I GGNNCC 2 cut(s) 44, 211
PspPI GGNCC 1 cut(s) 215
SaqAI TTAA 2 cut(s) 69, 220
Sau3AI GATC 1 cut(s) 203
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 166
SetI ASST 5 cut(s) 60, 133, 181, 194, 220
SfaNI GCATC 1 cut(s) 159
SinI GGWCC 1 cut(s) 215
SsiI CCGC 1 cut(s) 156
SspMI CTAG 2 cut(s) 35, 189
StyD4I CCNGG 1 cut(s) 172
TaqI TCGA 1 cut(s) 27
Tru1I TTAA 2 cut(s) 69, 220
Tru9I TTAA 2 cut(s) 69, 220
VpaK11BI GGWCC 1 cut(s) 215
XspI CTAG 2 cut(s) 35, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.