FvH4_4g05781

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
5169545 .. 5170250
706 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g05781.t1

Sequence Viewer

Length: 303 bp
ATGGTCCCCGCACGGCTTACTCCGGGTTTCGGGGTGAAATTTCGGGGTGGGTCGTGTCAGTACATCTCTCAAGGCCAAGCATCACTGTACGCCGTCACAAAAGGGTGGCGACGGCTCGTTGCCATAGCCAAAAGCAACGGCCACGCCCTCAACGGCGATGGCAAAAATGCCATAGCCATGTCGTCGCGGTTGCCCTTTAGCGACGGCAAACTAGCTTTTATCGACGGAATTGCGCCGTGGCTAATTGAATTCTTTTTTGTAGTAGTGGTGCGTGCGAATCGAAGCTTGGAAGTTCTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

10.83

Weight (kDa)

10.36

Isoelectric Point (pI)

42.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 187
AciI CCGC 2 cut(s) 9, 187
AcoI YGGCCR 1 cut(s) 139
AcsI RAATTY 2 cut(s) 38, 248
AfaI GTAC 2 cut(s) 62, 89
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 248
AjuI GAANNNNNNNTTGG 2 cut(s) 269, 301
AluBI AGCT 2 cut(s) 215, 285
AluI AGCT 2 cut(s) 215, 285
AoxI GGCC 2 cut(s) 73, 139
ApoI RAATTY 2 cut(s) 38, 248
AspLEI GCGC 1 cut(s) 235
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 1 cut(s) 24
AsuHPI GGTGA 1 cut(s) 46
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 152
BceAI ACGGC 7 cut(s) 29, 77, 128, 154, 169, 220, 220
BcgI CGANNNNNNTGC 2 cut(s) 212, 246
BcnI CCSGG 1 cut(s) 24
BfaI CTAG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 24
BmsI GCATC 1 cut(s) 89
BpuEI CTTGAG 1 cut(s) 54
BpuMI CCSGG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 29
Bsh1236I CGCG 1 cut(s) 187
BshFI GGCC 2 cut(s) 75, 141
BsiSI CCGG 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 29
BsnI GGCC 2 cut(s) 75, 141
BspACI CCGC 2 cut(s) 9, 187
BspANI GGCC 2 cut(s) 75, 141
BspFNI CGCG 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 236
Bst4CI ACNGT 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 273
BstDSI CCRYGG 1 cut(s) 236
BstFNI CGCG 1 cut(s) 187
BstHHI GCGC 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 22
BstUI CGCG 1 cut(s) 187
BsuRI GGCC 2 cut(s) 75, 141
BtgI CCRYGG 1 cut(s) 236
BtgZI GCGATG 1 cut(s) 171
BtsIMutI CAGTG 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 273
CfoI GCGC 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 2 cut(s) 61, 88
CviAII CATG 1 cut(s) 178
CviJI RGCY 9 cut(s) 16, 75, 115, 128, 141, 176, 215, 241, 285
CviKI_1 RGCY 9 cut(s) 16, 75, 115, 128, 141, 176, 215, 241, 285
CviQI GTAC 2 cut(s) 61, 88
EaeI YGGCCR 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 4
EcoRI GAATTC 1 cut(s) 248
FaeI CATG 1 cut(s) 181
FaiI YATR 3 cut(s) 125, 173, 179
FalI AAGNNNNNCTT 1 cut(s) 282
FatI CATG 1 cut(s) 177
FauI CCCGC 1 cut(s) 16
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 234
HaeIII GGCC 2 cut(s) 75, 141
HapII CCGG 1 cut(s) 23
HhaI GCGC 1 cut(s) 235
Hin1II CATG 1 cut(s) 181
Hin6I GCGC 1 cut(s) 233
HinP1I GCGC 1 cut(s) 233
HindIII AAGCTT 1 cut(s) 283
HinfI GANTC 1 cut(s) 277
HpaII CCGG 1 cut(s) 23
HphI GGTGA 1 cut(s) 46
Hpy99I CGWCG 4 cut(s) 114, 187, 206, 227
HpyCH4III ACNGT 1 cut(s) 87
Hsp92II CATG 1 cut(s) 181
HspAI GCGC 1 cut(s) 233
LpnPI CCDG 1 cut(s) 36
LweI GCATC 1 cut(s) 89
MaeI CTAG 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 94
MluCI AATT 4 cut(s) 38, 228, 243, 248
MnlI CCTC 1 cut(s) 158
MslI CAYNNNNRTG 1 cut(s) 176
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 24
MvnI CGCG 1 cut(s) 187
NciI CCSGG 1 cut(s) 24
NlaIII CATG 1 cut(s) 181
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 277
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 2 cut(s) 62, 89
RsaNI GTAC 2 cut(s) 61, 88
RseI CAYNNNNRTG 1 cut(s) 176
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 24
SetI ASST 2 cut(s) 217, 287
SfaNI GCATC 1 cut(s) 89
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 4 cut(s) 38, 228, 243, 248
SsiI CCGC 2 cut(s) 9, 187
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 22
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 2 cut(s) 222, 280
TasI AATT 4 cut(s) 38, 228, 243, 248
TatI WGTACW 1 cut(s) 60
TfiI GAWTC 1 cut(s) 277
TscAI CASTG 1 cut(s) 90
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspGWI ACGGA 1 cut(s) 240
TspRI CASTG 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 2 cut(s) 38, 248
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.