Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002986.1

Orthogroup ID

OG0003686

Physical Location & Seq

Genomic Coordinates Forward (+)

260693 .. 266627

Gene Structure 5935 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002986.1_g000053.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

atgaatggcgccgttgctttggtggttgttgtaatctgtttggagagtagagttggtttccattcatttgggagatacattcaggtgcctccgcctttgaattacctttcggtgactactacaatgcttggaggtgcagctggagctggtgcctatgcactgggtatgatatctgatgccttcagctccctcgctttcactgctctggctgttgtagttagtgttgctggagctatcgttgtcggatttcctgttttgttggctactatttggttggagcacaaggattccctagctgtagcggttggtggcgtcgccattggtatttgcgacggcatttttccgtcgcaaaattcttgctacggcaaacgtttgccgtcgctaatagtcttgcgacggggaattgccgtggcaaataacattggcgacgccaccaacggcgtcggaagcattgccgtcgcagagccgtcgccaatgctcttttgcgacggcaaaagaggcttttgcgatggcattgcgccgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

174

Amino Acids

17.65

Weight (kDa)

6.69

Isoelectric Point (pI)

38.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003686)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29120 FvH4_1g29701 FvH4_2g10340 FvH4_3g26319 FvH4_4g05781 FvH4_4g16191 FvH4_4g17212 FvH4_4g18132 FvH4_6g16754 FvH4_6g23731
rosa_chinensis	RchiOBHm_Chr0c29g0501111 RchiOBHm_Chr2g0126951 RchiOBHm_Chr2g0133761 RchiOBHm_Chr4g0407741 RchiOBHm_Chr6g0278911
rosa_laevigata	RLG00000034039
rosa_multiflora	Rmu_co8166508.1_g000001 Rmu_sc0002986.1_g000053 Rmu_sc0005664.1_g000049
rosa_roxburghii	Rroxscaffold_3G00250140 Rroxscaffold_5G00362530 Rroxscaffold_6G00423300
rosa_rugosa	Rorug04G0115900 Rorug04G0116000 Rorug04G0116000 Rorug04G0178600 Rorug04G0178700 Rorug04G0178800 Rorug04G0178800 Rorug05G0495800
rosa_samantha	Rh1CG126400 Rh4AG111400 Rh4BG376900 Rh6BG350300 Rh6BG405500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	3 cut(s)	8, 85, 149
AciI	CCGC	2 cut(s)	92, 302
AclI	AACGTT	1 cut(s)	370
AcsI	RAATTY	1 cut(s)	352
AcuI	CTGAAG	1 cut(s)	166
AcyI	GRCGYC	4 cut(s)	9, 312, 429, 441
AgsI	TTSAA	1 cut(s)	100
AluBI	AGCT	5 cut(s)	140, 146, 186, 233, 296
AluI	AGCT	5 cut(s)	140, 146, 186, 233, 296
Alw21I	GWGCWC	1 cut(s)	282
ApeKI	GCWGC	1 cut(s)	137
ApoI	RAATTY	1 cut(s)	352
AspLEI	GCGC	2 cut(s)	11, 520
AsuHPI	GGTGA	1 cut(s)	124
BanI	GGYRCC	3 cut(s)	8, 85, 149
Bbv12I	GWGCWC	1 cut(s)	282
BbvI	GCAGC	1 cut(s)	149
BccI	CCATC	1 cut(s)	503
BceAI	ACGGC	9 cut(s)	349, 361, 379, 392, 440, 451, 454, 505, 505
BcgI	CGANNNNNNTGC	5 cut(s)	439, 450, 473, 484, 497
BfaI	CTAG	1 cut(s)	293
BfmI	CTRYAG	1 cut(s)	297
BfoI	RGCGCY	1 cut(s)	12
BisI	GCNGC	1 cut(s)	138
BlsI	GCNGC	1 cut(s)	139
BmiI	GGNNCC	3 cut(s)	10, 87, 151
BmrI	ACTGGG	1 cut(s)	170
BmsI	GCATC	1 cut(s)	166
BmuI	ACTGGG	1 cut(s)	170
BpmI	CTGGAG	2 cut(s)	162, 249
BsaHI	GRCGYC	4 cut(s)	9, 312, 429, 441
BsaJI	CCNNGG	1 cut(s)	408
BsaXI	ACNNNNNCTCC	2 cut(s)	222, 252
Bse1I	ACTGG	1 cut(s)	165
Bse3DI	GCAATG	2 cut(s)	450, 513
BseDI	CCNNGG	1 cut(s)	408
BseMI	GCAATG	2 cut(s)	450, 513
BseNI	ACTGG	1 cut(s)	165
BseXI	GCAGC	1 cut(s)	149
BsgI	GTGCAG	1 cut(s)	156
BshNI	GGYRCC	3 cut(s)	8, 85, 149
BsiHKAI	GWGCWC	1 cut(s)	282
Bsp1286I	GDGCHC	1 cut(s)	282
BspACI	CCGC	2 cut(s)	92, 302
BspLI	GGNNCC	3 cut(s)	10, 87, 151
BspT107I	GGYRCC	3 cut(s)	8, 85, 149
BsrDI	GCAATG	2 cut(s)	450, 513
BsrI	ACTGG	1 cut(s)	165
BssECI	CCNNGG	1 cut(s)	408
BssNI	GRCGYC	4 cut(s)	9, 312, 429, 441
BstACI	GRCGYC	4 cut(s)	9, 312, 429, 441
BstDSI	CCRYGG	1 cut(s)	408
BstH2I	RGCGCY	1 cut(s)	12
BstHHI	GCGC	2 cut(s)	11, 520
BstMWI	GCNNNNNNNGC	4 cut(s)	143, 200, 447, 498
BstSFI	CTRYAG	1 cut(s)	297
BstV1I	GCAGC	1 cut(s)	149
BstXI	CCANNNNNNTGG	1 cut(s)	68
BtgI	CCRYGG	1 cut(s)	408
BtsI	GCAGTG	1 cut(s)	198
BtsIMutI	CAGTG	2 cut(s)	158, 198
CfoI	GCGC	2 cut(s)	11, 520
CseI	GACGC	3 cut(s)	301, 430, 437
CviJI	RGCY	9 cut(s)	140, 146, 186, 209, 233, 263, 296, 466, 501
CviKI_1	RGCY	9 cut(s)	140, 146, 186, 209, 233, 263, 296, 466, 501
DinI	GGCGCC	1 cut(s)	10
EciI	GGCGGA	1 cut(s)	81
Eco32I	GATATC	1 cut(s)	171
Eco57I	CTGAAG	1 cut(s)	166
EcoRV	GATATC	1 cut(s)	171
EgeI	GGCGCC	1 cut(s)	10
EheI	GGCGCC	1 cut(s)	10
FaiI	YATR	2 cut(s)	156, 167
Fnu4HI	GCNGC	1 cut(s)	138
Fsp4HI	GCNGC	1 cut(s)	138
FspBI	CTAG	1 cut(s)	293
GlaI	GCGC	2 cut(s)	10, 519
GluI	GCNGC	1 cut(s)	138
GsuI	CTGGAG	2 cut(s)	162, 249
HaeII	RGCGCY	1 cut(s)	12
HgaI	GACGC	3 cut(s)	301, 430, 437
HhaI	GCGC	2 cut(s)	11, 520
Hin1I	GRCGYC	4 cut(s)	9, 312, 429, 441
Hin6I	GCGC	2 cut(s)	9, 518
HinP1I	GCGC	2 cut(s)	9, 518
HinfI	GANTC	1 cut(s)	287
HphI	GGTGA	1 cut(s)	124
Hpy188I	TCNGA	3 cut(s)	175, 245, 446
HpyAV	CCTTC	1 cut(s)	190
HpyCH4IV	ACGT	1 cut(s)	370
HpyCH4V	TGCA	2 cut(s)	137, 158
HpyF10VI	GCNNNNNNNGC	4 cut(s)	143, 200, 447, 498
HpySE526I	ACGT	1 cut(s)	370
Hsp92I	GRCGYC	4 cut(s)	9, 312, 429, 441
HspAI	GCGC	2 cut(s)	9, 518
KasI	GGCGCC	1 cut(s)	8
LmnI	GCTCC	4 cut(s)	143, 191, 230, 277
LpnPI	CCDG	7 cut(s)	68, 126, 132, 146, 191, 213, 264
Lsp1109I	GCAGC	1 cut(s)	149
LweI	GCATC	1 cut(s)	166
MaeI	CTAG	1 cut(s)	293
MaeII	ACGT	1 cut(s)	370
MaeIII	GTNAC	1 cut(s)	112
MhlI	GDGCHC	1 cut(s)	282
MluCI	AATT	3 cut(s)	100, 352, 402
Mly113I	GGCGCC	1 cut(s)	9
MmeI	TCCRAC	3 cut(s)	223, 255, 424
MnlI	CCTC	4 cut(s)	99, 125, 200, 491
MslI	CAYNNNNRTG	1 cut(s)	83
MspA1I	CMGCKG	1 cut(s)	140
MwoI	GCNNNNNNNGC	4 cut(s)	143, 200, 447, 498
NarI	GGCGCC	1 cut(s)	9
NlaIV	GGNNCC	3 cut(s)	10, 87, 151
NmuCI	GTSAC	1 cut(s)	112
PfeI	GAWTC	1 cut(s)	287
PkrI	GCNGC	1 cut(s)	139
PluTI	GGCGCC	1 cut(s)	12
Psp1406I	AACGTT	1 cut(s)	370
PspN4I	GGNNCC	3 cut(s)	10, 87, 151
PvuII	CAGCTG	1 cut(s)	140
RseI	CAYNNNNRTG	1 cut(s)	83
SatI	GCNGC	1 cut(s)	138
SduI	GDGCHC	1 cut(s)	282
SetI	ASST	9 cut(s)	87, 108, 136, 142, 148, 188, 235, 298, 373
SfaNI	GCATC	1 cut(s)	166
SfcI	CTRYAG	1 cut(s)	297
SfoI	GGCGCC	1 cut(s)	10
SmiMI	CAYNNNNRTG	1 cut(s)	83
Sse9I	AATT	3 cut(s)	100, 352, 402
SsiI	CCGC	2 cut(s)	92, 302
SspDI	GGCGCC	1 cut(s)	8
SspMI	CTAG	1 cut(s)	293
TaiI	ACGT	1 cut(s)	373
TasI	AATT	3 cut(s)	100, 352, 402
TfiI	GAWTC	1 cut(s)	287
TscAI	CASTG	2 cut(s)	165, 205
TseFI	GTSAC	1 cut(s)	112
TseI	GCWGC	1 cut(s)	137
Tsp45I	GTSAC	1 cut(s)	112
TspDTI	ATGAA	2 cut(s)	17, 54
TspGWI	ACGGA	1 cut(s)	333
TspRI	CASTG	2 cut(s)	165, 205
XapI	RAATTY	1 cut(s)	352
XspI	CTAG	1 cut(s)	293

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.