RchiOBHm_Chr4g0407741

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
30066457 .. 30069115
2659 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37896

Sequence Viewer

Length: 138 bp
ATGGATGCTCATGGATTGAATTACAACCACGCACTAGCCGAAAGCATCAGTTGGCTACTATTTGGTTGGAGCACAAGTATTCCCCTAGCTGGAGCACTGCTTTTGGCCTTAAGGCAACATTGTTCTGGAGAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

4.88

Weight (kDa)

5.73

Isoelectric Point (pI)

23.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 89
AflII CTTAAG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 19
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw21I GWGCWC 2 cut(s) 74, 97
AoxI GGCC 1 cut(s) 105
Bbv12I GWGCWC 2 cut(s) 74, 97
BfaI CTAG 2 cut(s) 35, 86
BfrI CTTAAG 1 cut(s) 109
BmsI GCATC 1 cut(s) 54
BpmI CTGGAG 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bsc4I CCNNNNNNNGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 89
BshFI GGCC 1 cut(s) 107
BsiHKAI GWGCWC 2 cut(s) 74, 97
BslI CCNNNNNNNGG 1 cut(s) 89
BsnI GGCC 1 cut(s) 107
Bsp1286I GDGCHC 2 cut(s) 74, 97
BspANI GGCC 1 cut(s) 107
BspTI CTTAAG 1 cut(s) 109
BstAFI CTTAAG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 10
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 95
BtsIMutI CAGTG 1 cut(s) 95
CviAII CATG 1 cut(s) 11
CviJI RGCY 4 cut(s) 38, 55, 89, 107
CviKI_1 RGCY 4 cut(s) 38, 55, 89, 107
FaeI CATG 1 cut(s) 14
FaiI YATR 1 cut(s) 12
FatI CATG 1 cut(s) 10
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 35, 86
GsuI CTGGAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 137
Hpy188III TCNNGA 1 cut(s) 126
Hsp92II CATG 1 cut(s) 14
LmnI GCTCC 2 cut(s) 69, 92
LpnPI CCDG 2 cut(s) 75, 111
LweI GCATC 1 cut(s) 54
MaeI CTAG 2 cut(s) 35, 86
MhlI GDGCHC 2 cut(s) 74, 97
MluCI AATT 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 47
MseI TTAA 1 cut(s) 110
MspCI CTTAAG 1 cut(s) 109
NlaIII CATG 1 cut(s) 14
PcsI WCGNNNNNNNCGW 1 cut(s) 36
SaqAI TTAA 1 cut(s) 110
SduI GDGCHC 2 cut(s) 74, 97
SetI ASST 1 cut(s) 91
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 6 cut(s) 23, 41, 47, 87, 98, 102
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 1 cut(s) 19
SspMI CTAG 2 cut(s) 35, 86
TasI AATT 1 cut(s) 19
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TscAI CASTG 1 cut(s) 102
TspRI CASTG 1 cut(s) 102
Vha464I CTTAAG 1 cut(s) 109
XspI CTAG 2 cut(s) 35, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.