Rorug05G0495800

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
67789175 .. 67789632
458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0495800.1

Sequence Viewer

Length: 258 bp
ATGGAGGCATATGCACCAAGAGTTCCAAGTTCAAATGTTAAGGGAAATGGTAATGGCAGCTTGAAGGAACAAATCATCAAGTCTAGGAAGGCTTGGAAGAAGATGAAGACCATGGAGGGAAACCAAGCTGCCAATACAAGAGCTTCTAGTTCACAAACCATGCATGAACCTCCAACTCAAGCTAGCCAAAACCTTAAAGCAAGAAAGGCACAGAAGAAAAGTCAACCTCAATCAGAATCAGAATATGTAGGATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.38

Weight (kDa)

10.2

Isoelectric Point (pI)

53.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 33, 64
AluBI AGCT 4 cut(s) 60, 128, 143, 182
AluI AGCT 4 cut(s) 60, 128, 143, 182
ApeKI GCWGC 2 cut(s) 57, 128
AsuNHI GCTAGC 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 113
BbvI GCAGC 2 cut(s) 69, 115
BfaI CTAG 3 cut(s) 84, 147, 183
BisI GCNGC 2 cut(s) 58, 129
BlsI GCNGC 2 cut(s) 59, 130
BmtI GCTAGC 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 113
BpuEI CTTGAG 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 111
BseXI GCAGC 2 cut(s) 69, 115
Bsp19I CCATGG 1 cut(s) 111
BspOI GCTAGC 1 cut(s) 186
BssECI CCNNGG 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 111
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstV1I GCAGC 2 cut(s) 69, 115
BstV2I GAAGAC 1 cut(s) 113
BtgI CCRYGG 1 cut(s) 111
Cac8I GCNNGC 1 cut(s) 184
CviAII CATG 3 cut(s) 112, 160, 164
CviJI RGCY 6 cut(s) 60, 92, 128, 143, 182, 186
CviKI_1 RGCY 6 cut(s) 60, 92, 128, 143, 182, 186
Eco130I CCWWGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 111
EcoT22I ATGCAT 1 cut(s) 165
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 3 cut(s) 115, 163, 167
FaiI YATR 6 cut(s) 10, 12, 113, 161, 165, 246
FatI CATG 3 cut(s) 111, 159, 163
FauNDI CATATG 1 cut(s) 10
Fnu4HI GCNGC 2 cut(s) 58, 129
Fsp4HI GCNGC 2 cut(s) 58, 129
FspBI CTAG 3 cut(s) 84, 147, 183
GluI GCNGC 2 cut(s) 58, 129
Hin1II CATG 3 cut(s) 115, 163, 167
HincII GTYRAC 1 cut(s) 224
HindII GTYRAC 1 cut(s) 224
HinfI GANTC 1 cut(s) 236
Hpy166II GTNNAC 2 cut(s) 152, 224
Hpy188I TCNGA 2 cut(s) 235, 241
Hpy8I GTNNAC 2 cut(s) 152, 224
HpyAV CCTTC 2 cut(s) 58, 82
HpyCH4V TGCA 2 cut(s) 14, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
Hsp92II CATG 3 cut(s) 115, 163, 167
Lsp1109I GCAGC 2 cut(s) 69, 115
MaeI CTAG 3 cut(s) 84, 147, 183
MboII GAAGA 4 cut(s) 109, 112, 118, 226
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 3 cut(s) 109, 180, 237
Mph1103I ATGCAT 1 cut(s) 165
MseI TTAA 2 cut(s) 39, 195
MwoI GCNNNNNNNGC 1 cut(s) 206
NcoI CCATGG 1 cut(s) 111
NdeI CATATG 1 cut(s) 10
NheI GCTAGC 1 cut(s) 182
NlaIII CATG 3 cut(s) 115, 163, 167
NsiI ATGCAT 1 cut(s) 165
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 2 cut(s) 59, 130
SaqAI TTAA 2 cut(s) 39, 195
SatI GCNGC 2 cut(s) 58, 129
SetI ASST 7 cut(s) 62, 130, 145, 172, 184, 195, 229
SmlI CTYRAG 1 cut(s) 177
SmoI CTYRAG 1 cut(s) 177
SspMI CTAG 3 cut(s) 84, 147, 183
StyI CCWWGG 1 cut(s) 111
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 2 cut(s) 39, 195
Tru9I TTAA 2 cut(s) 39, 195
TseI GCWGC 2 cut(s) 57, 128
TspDTI ATGAA 2 cut(s) 119, 180
XspI CTAG 3 cut(s) 84, 147, 183
Zsp2I ATGCAT 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.