FvH4_4g07650

Protein of unknown function (DUF1517)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0006404
Physical Location & Seq
Forward (+)
7065323 .. 7067216
1894 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g07650.t1

Sequence Viewer

Length: 846 bp
ATGGCAACAACTGCGCTGCTCATCGAAGCCAGTCCGTTGAAATTGAAGCAGCAAGGCACCCTCTTACGCACTTTTCGTCTTCTACCTTCAAAACCATTTAAATTCAGCTCTCAACGTTGTTTTGCTCCTAGTCTTAAACCACCACCTCATCGTTATTCTCTGTCTCGGTGCCTAGATGTTTGCAAAGATAAACGAGCAGCAGCAGCAAGCACTGATTTCAGTAGGTTATGGGGTGAGTGTCTTAAGGCATTGAGGAAACCGGCAACGGCTGCCGTGCTATTGGGTTTGTTGGTCATGCACAACCCCAACTTACCGGCCCTGGCTGCTCCGGTGGTGGGTCGGGTTGGTGCAAGGTGGACATCCAACATTACGACCCGGTCCTACTATCTATGGGAAGGTTCTTCAACCGAAATCAAAACCCGCCACGAAGAATTCCATGAACCCATTTGGGACTTGGGACCCATTTTTCTATACTGCCTGGGTCTATTTTTTCTCAGCCTTTTGCCTTTCCCCGACCTTGTGCTGAGTGTATTGGTCTTTTCGTGGACGATGGTTATGTTAAATTGTCGTCTTATATGTCATACAAGTGTTGTCAAGCTCCAGCTTCAGCTTAAATTGTCGAACACAGGGCAAATGGATCTTAATCGGATCGCTGAAACTGCAGAACCAAAAACGTTTGAGGGTTTGAGATATGTTTTGAGAGATACAGCAATAGCTCTACTTCGGCAACCTGATTATTGCATTTCCCGTTGCACATATGTGATTATACCGAAGTTCACTAGAGCGGCTGCGCTGCAATGCTTTGATACACTTGTTGTCAGAGAGAGGGCTGGATGTGATGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1517

Protein Analysis

282

Amino Acids

31.61

Weight (kDa)

9.47

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1517 PF07466 195 - 277 1.8e-12 Protein of unknown function (DUF1517)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 56, 168
AccBSI CCGCTC 1 cut(s) 785
AciI CCGC 2 cut(s) 421, 785
AclI AACGTT 2 cut(s) 115, 674
AclWI GGATC 2 cut(s) 645, 656
AcsI RAATTY 2 cut(s) 101, 431
AcuI CTGAAG 1 cut(s) 590
AfiI CCNNNNNNNGG 1 cut(s) 335
AflII CTTAAG 1 cut(s) 242
AgsI TTSAA 4 cut(s) 40, 46, 90, 405
AjnI CCWGG 2 cut(s) 318, 477
AleI CACNNNNGTG 1 cut(s) 758
AluBI AGCT 5 cut(s) 108, 598, 604, 610, 716
AluI AGCT 5 cut(s) 108, 598, 604, 610, 716
Alw26I GTCTC 1 cut(s) 168
AlwI GGATC 2 cut(s) 645, 656
AoxI GGCC 1 cut(s) 315
ApeKI GCWGC 9 cut(s) 16, 49, 197, 200, 203, 269, 323, 788, 793
ApoI RAATTY 2 cut(s) 101, 431
AspLEI GCGC 2 cut(s) 16, 793
AspS9I GGNCC 3 cut(s) 316, 378, 458
AsuC2I CCSGG 1 cut(s) 376
AsuHPI GGTGA 1 cut(s) 245
AvaII GGWCC 2 cut(s) 378, 458
BaeI ACNNNNGTAYC 2 cut(s) 798, 831
BanI GGYRCC 2 cut(s) 56, 168
BbsI GAAGAC 1 cut(s) 71
BbvI GCAGC 9 cut(s) 3, 61, 209, 212, 215, 256, 310, 775, 780
BccI CCATC 2 cut(s) 544, 833
BceAI ACGGC 2 cut(s) 257, 282
BciT130I CCWGG 2 cut(s) 320, 479
BcnI CCSGG 1 cut(s) 376
BcoDI GTCTC 1 cut(s) 168
BfaI CTAG 3 cut(s) 129, 173, 780
BfmI CTRYAG 1 cut(s) 660
BfrI CTTAAG 1 cut(s) 242
Bme1390I CCNGG 3 cut(s) 320, 376, 479
Bme18I GGWCC 2 cut(s) 378, 458
BmgT120I GGNCC 3 cut(s) 316, 378, 458
BmiI GGNNCC 4 cut(s) 58, 170, 459, 460
BmrFI CCNGG 3 cut(s) 320, 376, 479
BpiI GAAGAC 1 cut(s) 71
BpmI CTGGAG 1 cut(s) 584
BpuMI CCSGG 1 cut(s) 376
BsaBI GATNNNNATC 1 cut(s) 642
BsaJI CCNNGG 2 cut(s) 318, 478
BsaWI WCCGGW 1 cut(s) 328
Bsc4I CCNNNNNNNGG 1 cut(s) 335
Bse118I RCCGGY 2 cut(s) 259, 313
Bse1I ACTGG 1 cut(s) 30
Bse3DI GCAATG 1 cut(s) 803
Bse8I GATNNNNATC 1 cut(s) 642
BseBI CCWGG 2 cut(s) 320, 479
BseDI CCNNGG 2 cut(s) 318, 478
BseGI GGATG 2 cut(s) 359, 839
BseJI GATNNNNATC 1 cut(s) 642
BseLI CCNNNNNNNGG 1 cut(s) 335
BseMI GCAATG 1 cut(s) 803
BseMII CTCAG 2 cut(s) 508, 515
BseNI ACTGG 1 cut(s) 30
BseXI GCAGC 9 cut(s) 3, 61, 209, 212, 215, 256, 310, 775, 780
BshFI GGCC 1 cut(s) 317
BshNI GGYRCC 2 cut(s) 56, 168
BsiSI CCGG 4 cut(s) 260, 314, 329, 376
BslFI GGGAC 2 cut(s) 464, 471
BslI CCNNNNNNNGG 1 cut(s) 335
BsmAI GTCTC 1 cut(s) 168
BsmFI GGGAC 2 cut(s) 464, 471
BsnI GGCC 1 cut(s) 317
Bsp143I GATC 2 cut(s) 637, 648
BspACI CCGC 2 cut(s) 421, 785
BspANI GGCC 1 cut(s) 317
BspCNI CTCAG 2 cut(s) 507, 516
BspLI GGNNCC 4 cut(s) 58, 170, 459, 460
BspMAI CTGCAG 1 cut(s) 664
BspPI GGATC 2 cut(s) 645, 656
BspT107I GGYRCC 2 cut(s) 56, 168
BspTI CTTAAG 1 cut(s) 242
BsrBI CCGCTC 1 cut(s) 785
BsrDI GCAATG 1 cut(s) 803
BsrFI RCCGGY 2 cut(s) 259, 313
BsrI ACTGG 1 cut(s) 30
BssAI RCCGGY 2 cut(s) 259, 313
BssECI CCNNGG 2 cut(s) 318, 478
BssMI GATC 2 cut(s) 637, 648
Bst2UI CCWGG 2 cut(s) 320, 479
BstAFI CTTAAG 1 cut(s) 242
BstAPI GCANNNNNTGC 2 cut(s) 11, 269
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 2 cut(s) 494, 524
BstF5I GGATG 2 cut(s) 359, 839
BstHHI GCGC 2 cut(s) 16, 793
BstKTI GATC 2 cut(s) 640, 651
BstMAI GTCTC 1 cut(s) 168
BstMBI GATC 2 cut(s) 637, 648
BstMWI GCNNNNNNNGC 5 cut(s) 11, 203, 269, 323, 659
BstNI CCWGG 2 cut(s) 320, 479
BstSCI CCNGG 3 cut(s) 318, 374, 477
BstSFI CTRYAG 1 cut(s) 660
BstV1I GCAGC 9 cut(s) 3, 61, 209, 212, 215, 256, 310, 775, 780
BstV2I GAAGAC 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 637
BstYI RGATCY 1 cut(s) 637
BsuRI GGCC 1 cut(s) 317
BtsCI GGATG 2 cut(s) 359, 839
BtsIMutI CAGTG 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 208
CfoI GCGC 2 cut(s) 16, 793
Cfr10I RCCGGY 2 cut(s) 259, 313
Cfr13I GGNCC 3 cut(s) 316, 378, 458
CviAII CATG 2 cut(s) 295, 437
DdeI CTNAG 2 cut(s) 494, 524
DpnI GATC 2 cut(s) 639, 650
DpnII GATC 2 cut(s) 637, 648
DraI TTTAAA 1 cut(s) 100
Eco47I GGWCC 2 cut(s) 378, 458
Eco57I CTGAAG 1 cut(s) 590
EcoO109I RGGNCCY 1 cut(s) 458
EcoRI GAATTC 1 cut(s) 431
EcoRII CCWGG 2 cut(s) 318, 477
FaeI CATG 2 cut(s) 298, 440
FaqI GGGAC 2 cut(s) 464, 471
FatI CATG 2 cut(s) 294, 436
FauI CCCGC 1 cut(s) 428
FauNDI CATATG 1 cut(s) 757
FokI GGATG 1 cut(s) 346
FspBI CTAG 3 cut(s) 129, 173, 780
GlaI GCGC 2 cut(s) 15, 792
GsuI CTGGAG 1 cut(s) 584
HaeIII GGCC 1 cut(s) 317
HapII CCGG 4 cut(s) 260, 314, 329, 376
HhaI GCGC 2 cut(s) 16, 793
Hin1II CATG 2 cut(s) 298, 440
Hin6I GCGC 2 cut(s) 14, 791
HinP1I GCGC 2 cut(s) 14, 791
HpaII CCGG 4 cut(s) 260, 314, 329, 376
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 3 cut(s) 357, 546, 777
Hpy188I TCNGA 2 cut(s) 648, 821
Hpy8I GTNNAC 3 cut(s) 357, 546, 777
HpyAV CCTTC 2 cut(s) 96, 389
HpyCH4IV ACGT 2 cut(s) 115, 674
HpyCH4V TGCA 7 cut(s) 183, 298, 350, 662, 741, 753, 796
HpyF10VI GCNNNNNNNGC 5 cut(s) 11, 203, 269, 323, 659
HpyF3I CTNAG 2 cut(s) 494, 524
HpySE526I ACGT 2 cut(s) 115, 674
Hsp92II CATG 2 cut(s) 298, 440
HspAI GCGC 2 cut(s) 14, 791
KflI GGGWCCC 1 cut(s) 458
Kzo9I GATC 2 cut(s) 637, 648
LmnI GCTCC 3 cut(s) 130, 331, 603
Lsp1109I GCAGC 9 cut(s) 3, 61, 209, 212, 215, 256, 310, 775, 780
MaeI CTAG 3 cut(s) 129, 173, 780
MaeII ACGT 2 cut(s) 115, 674
MalI GATC 2 cut(s) 639, 650
MbiI CCGCTC 1 cut(s) 785
MboI GATC 2 cut(s) 637, 648
MboII GAAGA 3 cut(s) 71, 393, 440
MflI RGATCY 1 cut(s) 637
MluCI AATT 5 cut(s) 41, 101, 431, 562, 614
MmeI TCCRAC 1 cut(s) 387
MnlI CCTC 5 cut(s) 71, 156, 246, 673, 819
MseI TTAA 6 cut(s) 99, 135, 243, 560, 612, 642
MslI CAYNNNNRTG 2 cut(s) 585, 758
MspCI CTTAAG 1 cut(s) 242
MspI CCGG 4 cut(s) 260, 314, 329, 376
MspR9I CCNGG 3 cut(s) 320, 376, 479
MvaI CCWGG 2 cut(s) 320, 479
MwoI GCNNNNNNNGC 5 cut(s) 11, 203, 269, 323, 659
NciI CCSGG 1 cut(s) 376
NdeI CATATG 1 cut(s) 757
NdeII GATC 2 cut(s) 637, 648
NlaIII CATG 2 cut(s) 298, 440
NlaIV GGNNCC 4 cut(s) 58, 170, 459, 460
OliI CACNNNNGTG 1 cut(s) 758
PcsI WCGNNNNNNNCGW 1 cut(s) 73
PflFI GACNNNGTC 1 cut(s) 376
PpuMI RGGWCCY 1 cut(s) 458
Psp1406I AACGTT 2 cut(s) 115, 674
Psp5II RGGWCCY 1 cut(s) 458
Psp6I CCWGG 2 cut(s) 318, 477
PspGI CCWGG 2 cut(s) 318, 477
PspN4I GGNNCC 4 cut(s) 58, 170, 459, 460
PspPI GGNCC 3 cut(s) 316, 378, 458
PspPPI RGGWCCY 1 cut(s) 458
PstI CTGCAG 1 cut(s) 664
PsuI RGATCY 1 cut(s) 637
PsyI GACNNNGTC 1 cut(s) 376
RseI CAYNNNNRTG 2 cut(s) 585, 758
SaqAI TTAA 6 cut(s) 99, 135, 243, 560, 612, 642
Sau3AI GATC 2 cut(s) 637, 648
Sau96I GGNCC 3 cut(s) 316, 378, 458
ScrFI CCNGG 3 cut(s) 320, 376, 479
SfcI CTRYAG 1 cut(s) 660
SinI GGWCC 2 cut(s) 378, 458
SmiI ATTTAAAT 1 cut(s) 100
SmiMI CAYNNNNRTG 2 cut(s) 585, 758
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 5 cut(s) 41, 101, 431, 562, 614
SsiI CCGC 2 cut(s) 421, 785
SspMI CTAG 3 cut(s) 129, 173, 780
StyD4I CCNGG 3 cut(s) 318, 374, 477
SwaI ATTTAAAT 1 cut(s) 100
TaiI ACGT 2 cut(s) 118, 677
TaqI TCGA 2 cut(s) 24, 620
TasI AATT 5 cut(s) 41, 101, 431, 562, 614
TauI GCSGC 1 cut(s) 788
Tru1I TTAA 6 cut(s) 99, 135, 243, 560, 612, 642
Tru9I TTAA 6 cut(s) 99, 135, 243, 560, 612, 642
TscAI CASTG 1 cut(s) 217
TseI GCWGC 9 cut(s) 16, 49, 197, 200, 203, 269, 323, 788, 793
TspDTI ATGAA 1 cut(s) 453
TspGWI ACGGA 1 cut(s) 24
TspRI CASTG 1 cut(s) 217
Tth111I GACNNNGTC 1 cut(s) 376
Vha464I CTTAAG 1 cut(s) 242
VpaK11BI GGWCC 2 cut(s) 378, 458
XapI RAATTY 2 cut(s) 101, 431
XcmI CCANNNNNNNNNTGG 1 cut(s) 451
XspI CTAG 3 cut(s) 129, 173, 780
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.