MD00G1108400.v1.1

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0002880
Physical Location & Seq
Reverse (-)
22785017 .. 22785661
645 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1108400.v1.1.491

Sequence Viewer

Length: 645 bp
ATGCCTCACAGCACAGTGGTTTACGTATGCCTTGGAAGCCTCAGCCAAGTCGCAACCCTTCAATTGGTAGAGCTTGGTTTGGGATTAGAAGCGTCGAACCGGCCTTTCATTTGGGTGACTAGAAACAAAACTGAGGAATGGGAAAAATGGTTAGAAGAAGATGGATTTGAGGATAGGACAAAAGGGAGAGGCGTGTTGATCCATGGTTGGGCTTCACAAGTACTTATTTTGTCACACCCTGTAGTTGGGGCATTTTTGATGCATTGCGGTTGGAATTCAACGTTGGAAGGGATTTGTACTGGGATTCCAATGATATCTTGGCCTCTGTTTGCGGAGCAGTTCTACAACGAGAAGCTCATAGTGCAAGTGTTGAAGATCAGTGAGAGCGTAGGGGCGAAAGCTGTAATTCCACTAGGGGAACAAGGTAAATCCGAGATGTTGGTGAAGATGGGTGAGTTTAAGGAGGTCGTAGACAAAGTGATGGACAAGGAAGGAAAAGAAGCAGAAGTGAAAAGAGAAAGAGCAAGAGAGCTTGCAATTTTGGCTAACAAAGCTACAGAAGGGGGAGGATCTTCTTACCTTAACATGAAACTACTGATTGAAGATATAAGATCCTACAAAACTAGCAACGTTCATTTAGGCTAA

Protein Analysis

215

Amino Acids

23.85

Weight (kDa)

5.8

Isoelectric Point (pI)

37.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UDPGT PF00201 5 - 121 5.2e-19 UDP-glucoronosyl and UDP-glucosyl transferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 471
AciI CCGC 2 cut(s) 267, 332
AclI AACGTT 2 cut(s) 281, 630
AclWI GGATC 3 cut(s) 193, 577, 606
AcsI RAATTY 1 cut(s) 274
AfaI GTAC 2 cut(s) 222, 298
AfiI CCNNNNNNNGG 3 cut(s) 64, 208, 245
AgsI TTSAA 4 cut(s) 62, 279, 373, 602
AjuI GAANNNNNNNTTGG 2 cut(s) 266, 298
AluBI AGCT 5 cut(s) 73, 355, 401, 532, 554
AluI AGCT 5 cut(s) 73, 355, 401, 532, 554
AlwI GGATC 3 cut(s) 193, 577, 606
AoxI GGCC 2 cut(s) 101, 320
ApoI RAATTY 1 cut(s) 274
AsuHPI GGTGA 3 cut(s) 127, 454, 464
BbvCI CCTCAGC 1 cut(s) 41
BccI CCATC 3 cut(s) 155, 442, 475
BfaI CTAG 3 cut(s) 120, 413, 624
BfmI CTRYAG 2 cut(s) 240, 555
BmcAI AGTACT 1 cut(s) 222
BmrI ACTGGG 1 cut(s) 309
BmsI GCATC 1 cut(s) 249
BmuI ACTGGG 1 cut(s) 309
Bpu10I CCTNAGC 1 cut(s) 41
BsaAI YACGTR 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 31, 202
Bsc4I CCNNNNNNNGG 3 cut(s) 64, 208, 245
Bse118I RCCGGY 1 cut(s) 99
Bse1I ACTGG 1 cut(s) 304
Bse3DI GCAATG 1 cut(s) 262
BseDI CCNNGG 2 cut(s) 31, 202
BseLI CCNNNNNNNGG 3 cut(s) 64, 208, 245
BseMI GCAATG 1 cut(s) 262
BseMII CTCAG 2 cut(s) 55, 123
BseNI ACTGG 1 cut(s) 304
BshFI GGCC 2 cut(s) 103, 322
BsiSI CCGG 1 cut(s) 100
BslI CCNNNNNNNGG 3 cut(s) 64, 208, 245
BsnI GGCC 2 cut(s) 103, 322
Bsp143I GATC 4 cut(s) 198, 375, 569, 611
Bsp19I CCATGG 1 cut(s) 202
BspACI CCGC 2 cut(s) 267, 332
BspANI GGCC 2 cut(s) 103, 322
BspCNI CTCAG 2 cut(s) 54, 124
BspPI GGATC 3 cut(s) 193, 577, 606
BsrDI GCAATG 1 cut(s) 262
BsrFI RCCGGY 1 cut(s) 99
BsrI ACTGG 1 cut(s) 304
BssAI RCCGGY 1 cut(s) 99
BssECI CCNNGG 2 cut(s) 31, 202
BssMI GATC 4 cut(s) 198, 375, 569, 611
BssT1I CCWWGG 2 cut(s) 31, 202
Bst4CI ACNGT 1 cut(s) 16
BstBAI YACGTR 1 cut(s) 25
BstC8I GCNNGC 1 cut(s) 534
BstDEI CTNAG 2 cut(s) 41, 132
BstDSI CCRYGG 1 cut(s) 202
BstKTI GATC 4 cut(s) 201, 378, 572, 614
BstMBI GATC 4 cut(s) 198, 375, 569, 611
BstMWI GCNNNNNNNGC 4 cut(s) 36, 361, 542, 551
BstSFI CTRYAG 2 cut(s) 240, 555
BstSNI TACGTA 1 cut(s) 25
BstX2I RGATCY 2 cut(s) 569, 611
BstYI RGATCY 2 cut(s) 569, 611
BsuRI GGCC 2 cut(s) 103, 322
BtgI CCRYGG 1 cut(s) 202
BtsIMutI CAGTG 2 cut(s) 21, 385
Cac8I GCNNGC 1 cut(s) 534
Cfr10I RCCGGY 1 cut(s) 99
CseI GACGC 1 cut(s) 81
Csp6I GTAC 2 cut(s) 221, 297
CviAII CATG 2 cut(s) 203, 586
CviQI GTAC 2 cut(s) 221, 297
DdeI CTNAG 2 cut(s) 41, 132
DpnI GATC 4 cut(s) 200, 377, 571, 613
DpnII GATC 4 cut(s) 198, 375, 569, 611
Eco105I TACGTA 1 cut(s) 25
Eco130I CCWWGG 2 cut(s) 31, 202
Eco32I GATATC 1 cut(s) 315
EcoRI GAATTC 1 cut(s) 274
EcoRV GATATC 1 cut(s) 315
EcoT14I CCWWGG 2 cut(s) 31, 202
EcoT22I ATGCAT 1 cut(s) 264
ErhI CCWWGG 2 cut(s) 31, 202
FaeI CATG 2 cut(s) 206, 589
FaiI YATR 5 cut(s) 28, 204, 359, 587, 608
FatI CATG 2 cut(s) 202, 585
FblI GTMKAC 1 cut(s) 471
FspBI CTAG 3 cut(s) 120, 413, 624
HaeIII GGCC 2 cut(s) 103, 322
HapII CCGG 1 cut(s) 100
HgaI GACGC 1 cut(s) 81
Hin1II CATG 2 cut(s) 206, 589
HinfI GANTC 1 cut(s) 304
HpaII CCGG 1 cut(s) 100
HphI GGTGA 3 cut(s) 127, 454, 464
Hpy166II GTNNAC 2 cut(s) 22, 472
Hpy188I TCNGA 1 cut(s) 433
Hpy8I GTNNAC 2 cut(s) 22, 472
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 4 cut(s) 68, 281, 485, 554
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4IV ACGT 3 cut(s) 24, 281, 630
HpyCH4V TGCA 3 cut(s) 262, 364, 536
HpyF10VI GCNNNNNNNGC 4 cut(s) 36, 361, 542, 551
HpyF3I CTNAG 2 cut(s) 41, 132
HpySE526I ACGT 3 cut(s) 24, 281, 630
Hsp92II CATG 2 cut(s) 206, 589
Kzo9I GATC 4 cut(s) 198, 375, 569, 611
LmnI GCTCC 1 cut(s) 334
LpnPI CCDG 3 cut(s) 113, 252, 285
LweI GCATC 1 cut(s) 249
MaeI CTAG 3 cut(s) 120, 413, 624
MaeII ACGT 3 cut(s) 24, 281, 630
MaeIII GTNAC 2 cut(s) 115, 231
MalI GATC 4 cut(s) 200, 377, 571, 613
MboI GATC 4 cut(s) 198, 375, 569, 611
MboII GAAGA 6 cut(s) 167, 170, 385, 457, 564, 614
MfeI CAATTG 1 cut(s) 62
MflI RGATCY 2 cut(s) 569, 611
MluCI AATT 4 cut(s) 62, 274, 405, 537
MmeI TCCRAC 2 cut(s) 251, 264
MnlI CCTC 8 cut(s) 15, 50, 127, 163, 182, 333, 457, 560
Mph1103I ATGCAT 1 cut(s) 264
MseI TTAA 2 cut(s) 459, 582
MslI CAYNNNNRTG 1 cut(s) 113
MspI CCGG 1 cut(s) 100
MunI CAATTG 1 cut(s) 62
MwoI GCNNNNNNNGC 4 cut(s) 36, 361, 542, 551
NcoI CCATGG 1 cut(s) 202
NdeII GATC 4 cut(s) 198, 375, 569, 611
NlaIII CATG 2 cut(s) 206, 589
NmuCI GTSAC 2 cut(s) 115, 231
NsiI ATGCAT 1 cut(s) 264
PfeI GAWTC 1 cut(s) 304
Ppu21I YACGTR 1 cut(s) 25
Psp1406I AACGTT 2 cut(s) 281, 630
PsuI RGATCY 2 cut(s) 569, 611
RsaI GTAC 2 cut(s) 222, 298
RsaNI GTAC 2 cut(s) 221, 297
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 2 cut(s) 459, 582
Sau3AI GATC 4 cut(s) 198, 375, 569, 611
ScaI AGTACT 1 cut(s) 222
SfaNI GCATC 1 cut(s) 249
SfcI CTRYAG 2 cut(s) 240, 555
SmiMI CAYNNNNRTG 1 cut(s) 113
SnaBI TACGTA 1 cut(s) 25
Sse9I AATT 4 cut(s) 62, 274, 405, 537
SsiI CCGC 2 cut(s) 267, 332
SspMI CTAG 3 cut(s) 120, 413, 624
StyI CCWWGG 2 cut(s) 31, 202
TaaI ACNGT 1 cut(s) 16
TaiI ACGT 3 cut(s) 27, 284, 633
TaqI TCGA 1 cut(s) 95
TasI AATT 4 cut(s) 62, 274, 405, 537
TatI WGTACW 2 cut(s) 220, 296
TfiI GAWTC 1 cut(s) 304
Tru1I TTAA 2 cut(s) 459, 582
Tru9I TTAA 2 cut(s) 459, 582
TscAI CASTG 2 cut(s) 21, 385
TseFI GTSAC 2 cut(s) 115, 231
Tsp45I GTSAC 2 cut(s) 115, 231
TspDTI ATGAA 3 cut(s) 97, 602, 623
TspRI CASTG 2 cut(s) 21, 385
XapI RAATTY 1 cut(s) 274
XcmI CCANNNNNNNNNTGG 1 cut(s) 315
XmiI GTMKAC 1 cut(s) 471
XspI CTAG 3 cut(s) 120, 413, 624
ZrmI AGTACT 1 cut(s) 222
Zsp2I ATGCAT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.