Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0004224

Physical Location & Seq

Genomic Coordinates Forward (+)

40624012 .. 40624314

Gene Structure 303 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1270300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

ATGCAAATTATGCATCGATATGTGAAAGCGACAAATATACTATTAGATGTAAATTACACTACAAAAGTGTCAAACTTTGGAGCTTCACAATTGATTCCTCTAGACCAAGCTCAACTTGCAACTTTAGTGCAAGGAACATTCGAATACTTAGACCCTGAATACTTCCTCACGAATCAACTAACAGAAAAGAGTGATGTCTATAGCTTTGGAGTTGTCCTGATGGAGCTACTAACAAGCAAAGTGGCACTCGCTTTTGACAGGCCTGAGGAAGAGAGAAACCTAGCAAGCTTTTTTGTTTGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EGF EGF_CA GUB_WAK_bind Pkinase Pkinase_Tyr WAK hEGF

Protein Analysis

101

Amino Acids

11.4

Weight (kDa)

4.61

Isoelectric Point (pI)

28.32

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pkinase	PF00069	2 - 84	3.3e-16	Protein kinase domain
PK_Tyr_Ser-Thr	PF07714	2 - 78	8.5e-16	Protein tyrosine and serine/threonine kinase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004224)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g10610
malus_domestica	MD05G1270300.v1.1 MD05G1270700.v1.1
rosa_chinensis	RchiOBHm_Chr1g0329511 RchiOBHm_Chr1g0336171 RchiOBHm_Chr5g0016711 RchiOBHm_Chr5g0016781 RchiOBHm_Chr5g0016821 RchiOBHm_Chr5g0017081 RchiOBHm_Chr5g0017111 RchiOBHm_Chr5g0017281 RchiOBHm_Chr5g0017311 RchiOBHm_Chr5g0054731
rosa_laevigata	RLG00000002400 RLG00000023080 RLG00000029879 RLG00000029880
rosa_multiflora	Rmu_sc0000441.1_g000086 Rmu_sc0001235.1_g000006 Rmu_sc0001423.1_g000044 Rmu_sc0003630.1_g000003 Rmu_sc0003801.1_g000025 Rmu_sc0005319.1_g000021 Rmu_sc0005418.1_g000011 Rmu_sc0008053.1_g000024
rosa_roxburghii	Rroxscaffold_1G00012580 Rroxscaffold_1G00013300 Rroxscaffold_4G00321010 Rroxscaffold_6G00395830 Rroxscaffold_6G00395840
rosa_rugosa	Rorug03G0224700
rosa_wichuraiana	Rw3G024380 Rw3G024480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	5 cut(s)	83, 110, 204, 226, 288
AluI	AGCT	5 cut(s)	83, 110, 204, 226, 288
AoxI	GGCC	1 cut(s)	260
AsuII	TTCGAA	1 cut(s)	141
AxyI	CCTNAGG	1 cut(s)	264
BccI	CCATC	1 cut(s)	214
BfaI	CTAG	2 cut(s)	101, 281
BfmI	CTRYAG	1 cut(s)	199
BmsI	GCATC	1 cut(s)	22
Bpu14I	TTCGAA	1 cut(s)	141
Bsa29I	ATCGAT	1 cut(s)	16
Bse21I	CCTNAGG	1 cut(s)	264
BseCI	ATCGAT	1 cut(s)	16
BseMII	CTCAG	1 cut(s)	255
BshFI	GGCC	1 cut(s)	262
BshVI	ATCGAT	1 cut(s)	16
BsnI	GGCC	1 cut(s)	262
Bsp119I	TTCGAA	1 cut(s)	141
BspANI	GGCC	1 cut(s)	262
BspCNI	CTCAG	1 cut(s)	256
BspDI	ATCGAT	1 cut(s)	16
BspT104I	TTCGAA	1 cut(s)	141
Bst6I	CTCTTC	1 cut(s)	264
BstAPI	GCANNNNNTGC	1 cut(s)	10
BstBI	TTCGAA	1 cut(s)	141
BstC8I	GCNNGC	1 cut(s)	286
BstDEI	CTNAG	2 cut(s)	148, 264
BstMWI	GCNNNNNNNGC	2 cut(s)	10, 116
BstSFI	CTRYAG	1 cut(s)	199
Bsu15I	ATCGAT	1 cut(s)	16
Bsu36I	CCTNAGG	1 cut(s)	264
BsuRI	GGCC	1 cut(s)	262
BsuTUI	ATCGAT	1 cut(s)	16
Cac8I	GCNNGC	1 cut(s)	286
ClaI	ATCGAT	1 cut(s)	16
CspCI	CAANNNNNGTGG	2 cut(s)	222, 257
CviJI	RGCY	6 cut(s)	83, 110, 204, 226, 262, 288
CviKI_1	RGCY	6 cut(s)	83, 110, 204, 226, 262, 288
DdeI	CTNAG	2 cut(s)	148, 264
Eam1104I	CTCTTC	1 cut(s)	264
EarI	CTCTTC	1 cut(s)	264
Eco147I	AGGCCT	1 cut(s)	262
Eco81I	CCTNAGG	1 cut(s)	264
EcoT22I	ATGCAT	1 cut(s)	15
FaiI	YATR	4 cut(s)	11, 21, 38, 201
FalI	AAGNNNNNCTT	2 cut(s)	99, 131
FspBI	CTAG	2 cut(s)	101, 281
HaeIII	GGCC	1 cut(s)	262
HindIII	AAGCTT	1 cut(s)	286
HinfI	GANTC	2 cut(s)	94, 172
Hpy188III	TCNNGA	3 cut(s)	101, 169, 217
HpyCH4V	TGCA	4 cut(s)	4, 13, 119, 130
HpyF10VI	GCNNNNNNNGC	2 cut(s)	10, 116
HpyF3I	CTNAG	2 cut(s)	148, 264
LmnI	GCTCC	2 cut(s)	80, 223
LpnPI	CCDG	4 cut(s)	168, 230, 244, 276
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	2 cut(s)	101, 281
MboII	GAAGA	1 cut(s)	281
MfeI	CAATTG	1 cut(s)	89
MluCI	AATT	3 cut(s)	6, 52, 89
MnlI	CCTC	3 cut(s)	108, 176, 259
Mph1103I	ATGCAT	1 cut(s)	15
MseI	TTAA	1 cut(s)	301
MslI	CAYNNNNRTG	1 cut(s)	18
MunI	CAATTG	1 cut(s)	89
MwoI	GCNNNNNNNGC	2 cut(s)	10, 116
NsiI	ATGCAT	1 cut(s)	15
NspV	TTCGAA	1 cut(s)	141
PceI	AGGCCT	1 cut(s)	262
PfeI	GAWTC	2 cut(s)	94, 172
RseI	CAYNNNNRTG	1 cut(s)	18
SaqAI	TTAA	1 cut(s)	301
SetI	ASST	6 cut(s)	85, 112, 206, 228, 282, 290
SfaNI	GCATC	1 cut(s)	22
SfcI	CTRYAG	1 cut(s)	199
SfuI	TTCGAA	1 cut(s)	141
SmiMI	CAYNNNNRTG	1 cut(s)	18
Sse9I	AATT	3 cut(s)	6, 52, 89
SseBI	AGGCCT	1 cut(s)	262
SspMI	CTAG	2 cut(s)	101, 281
StuI	AGGCCT	1 cut(s)	262
TaqI	TCGA	2 cut(s)	16, 141
TasI	AATT	3 cut(s)	6, 52, 89
TfiI	GAWTC	2 cut(s)	94, 172
Tru1I	TTAA	1 cut(s)	301
Tru9I	TTAA	1 cut(s)	301
XbaI	TCTAGA	1 cut(s)	100
XspI	CTAG	2 cut(s)	101, 281
Zsp2I	ATGCAT	1 cut(s)	15

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.