Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001235.1

Orthogroup ID

OG0004224

Physical Location & Seq

Genomic Coordinates Reverse (-)

31529 .. 33109

Gene Structure 1581 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001235.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

atgacaacaatagtccaagaaacaacgacaactcatctttcaacaatcccattggatgccagatttgtgaaaatccagggcacaatgcttccatatgctattacaagaatggttttgaggcttccacctctgttgttgagtgtcaaatctgcaagagactcagtcacaatgctaaaacctacagatatagacaataatcaaacaacaactctgagaatggtccaacagctatggttgctcataatagcatcaattacttcaagatttcattattcactcaagttcatctcatcttggttgcacaaatggagtattttccatcatcaaaatccatgcctacaagctcaagttgaattcttgcacatgggcacaatgggatacttggacctcgaatatcttcagtccaacacactaacaaaaaagggtgacgtttatagctttggagttgtcctcgtggagctactgacaagcgagaatgcagttcgttttgataaatccaaggcagagagaaacctggccaacctctttgtttctacaattgaagaaaaggtctgcgtgtgctgggtccaattcttgatgatgaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 Retrotrans_gag rve zf-H2C2

Protein Analysis

195

Amino Acids

22.45

Weight (kDa)

9.01

Isoelectric Point (pI)

31.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004224)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g10610
malus_domestica	MD05G1270300.v1.1 MD05G1270700.v1.1
rosa_chinensis	RchiOBHm_Chr1g0329511 RchiOBHm_Chr1g0336171 RchiOBHm_Chr5g0016711 RchiOBHm_Chr5g0016781 RchiOBHm_Chr5g0016821 RchiOBHm_Chr5g0017081 RchiOBHm_Chr5g0017111 RchiOBHm_Chr5g0017281 RchiOBHm_Chr5g0017311 RchiOBHm_Chr5g0054731
rosa_laevigata	RLG00000002400 RLG00000023080 RLG00000029879 RLG00000029880
rosa_multiflora	Rmu_sc0000441.1_g000086 Rmu_sc0001235.1_g000006 Rmu_sc0001423.1_g000044 Rmu_sc0003630.1_g000003 Rmu_sc0003801.1_g000025 Rmu_sc0005319.1_g000021 Rmu_sc0005418.1_g000011 Rmu_sc0008053.1_g000024
rosa_roxburghii	Rroxscaffold_1G00012580 Rroxscaffold_1G00013300 Rroxscaffold_4G00321010 Rroxscaffold_6G00395830 Rroxscaffold_6G00395840
rosa_rugosa	Rorug03G0224700
rosa_wichuraiana	Rw3G024380 Rw3G024480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	516
AcsI	RAATTY	1 cut(s)	353
AcuI	CTGAAG	1 cut(s)	383
AgsI	TTSAA	4 cut(s)	42, 261, 353, 542
AjnI	CCWGG	2 cut(s)	75, 513
AluBI	AGCT	4 cut(s)	229, 344, 438, 460
AluI	AGCT	4 cut(s)	229, 344, 438, 460
Alw26I	GTCTC	1 cut(s)	150
AoxI	GGCC	1 cut(s)	516
ApoI	RAATTY	1 cut(s)	353
Asp700I	GAANNNNTTC	1 cut(s)	396
AspS9I	GGNCC	3 cut(s)	220, 385, 565
AsuHPI	GGTGA	1 cut(s)	437
AvaII	GGWCC	3 cut(s)	220, 385, 565
BaeGI	GKGCMC	2 cut(s)	83, 371
BalI	TGGCCA	1 cut(s)	518
BauI	CACGAG	1 cut(s)	452
BccI	CCATC	1 cut(s)	327
BciT130I	CCWGG	2 cut(s)	77, 515
BciVI	GTATCC	1 cut(s)	371
BcoDI	GTCTC	1 cut(s)	150
BfmI	CTRYAG	1 cut(s)	180
BfuI	GTATCC	1 cut(s)	371
Bme1390I	CCNGG	2 cut(s)	77, 515
Bme18I	GGWCC	3 cut(s)	220, 385, 565
BmgT120I	GGNCC	3 cut(s)	220, 385, 565
BmiI	GGNNCC	1 cut(s)	566
BmrFI	CCNGG	2 cut(s)	77, 515
BmsI	GCATC	2 cut(s)	46, 257
BplI	GAGNNNNNCTC	2 cut(s)	435, 467
BpuEI	CTTGAG	2 cut(s)	263, 330
BsaJI	CCNNGG	2 cut(s)	76, 498
BseBI	CCWGG	2 cut(s)	77, 515
BseDI	CCNNGG	2 cut(s)	76, 498
BseGI	GGATG	1 cut(s)	61
BseMII	CTCAG	2 cut(s)	174, 203
BseSI	GKGCMC	2 cut(s)	83, 371
BseYI	CCCAGC	1 cut(s)	561
BshFI	GGCC	1 cut(s)	518
BsmAI	GTCTC	1 cut(s)	150
BsmI	GAATGC	1 cut(s)	481
BsnI	GGCC	1 cut(s)	518
Bsp1286I	GDGCHC	2 cut(s)	83, 371
BspANI	GGCC	1 cut(s)	518
BspCNI	CTCAG	2 cut(s)	173, 204
BspLI	GGNNCC	1 cut(s)	566
BssECI	CCNNGG	2 cut(s)	76, 498
BssSI	CACGAG	1 cut(s)	452
BssT1I	CCWWGG	1 cut(s)	498
Bst2BI	CACGAG	1 cut(s)	452
Bst2UI	CCWGG	2 cut(s)	77, 515
BstDEI	CTNAG	2 cut(s)	160, 212
BstF5I	GGATG	1 cut(s)	61
BstMAI	GTCTC	1 cut(s)	150
BstMWI	GCNNNNNNNGC	1 cut(s)	235
BstNI	CCWGG	2 cut(s)	77, 515
BstSCI	CCNGG	2 cut(s)	75, 513
BstSFI	CTRYAG	1 cut(s)	180
BstSLI	GKGCMC	2 cut(s)	83, 371
BsuI	GTATCC	1 cut(s)	371
BsuRI	GGCC	1 cut(s)	518
BtsCI	GGATG	1 cut(s)	61
Cfr13I	GGNCC	3 cut(s)	220, 385, 565
CspCI	CAANNNNNGTGG	2 cut(s)	114, 149
CviAII	CATG	2 cut(s)	333, 364
CviJI	RGCY	6 cut(s)	121, 229, 344, 438, 460, 518
CviKI_1	RGCY	6 cut(s)	121, 229, 344, 438, 460, 518
DdeI	CTNAG	2 cut(s)	160, 212
EaeI	YGGCCR	1 cut(s)	516
Eco130I	CCWWGG	1 cut(s)	498
Eco47I	GGWCC	3 cut(s)	220, 385, 565
Eco57I	CTGAAG	1 cut(s)	383
EcoRI	GAATTC	1 cut(s)	353
EcoRII	CCWGG	2 cut(s)	75, 513
EcoT14I	CCWWGG	1 cut(s)	498
ErhI	CCWWGG	1 cut(s)	498
FaeI	CATG	2 cut(s)	336, 367
FaiI	YATR	8 cut(s)	94, 96, 188, 232, 242, 334, 365, 435
FatI	CATG	2 cut(s)	332, 363
FauNDI	CATATG	1 cut(s)	94
FokI	GGATG	1 cut(s)	68
GsaI	CCCAGC	1 cut(s)	565
HaeIII	GGCC	1 cut(s)	518
Hin1II	CATG	2 cut(s)	336, 367
HinfI	GANTC	1 cut(s)	158
HphI	GGTGA	1 cut(s)	437
Hpy188I	TCNGA	1 cut(s)	213
Hpy188III	TCNNGA	2 cut(s)	261, 574
HpyCH4IV	ACGT	1 cut(s)	429
HpyCH4V	TGCA	4 cut(s)	152, 301, 361, 479
HpyF10VI	GCNNNNNNNGC	1 cut(s)	235
HpyF3I	CTNAG	2 cut(s)	160, 212
HpySE526I	ACGT	1 cut(s)	429
Hsp92II	CATG	2 cut(s)	336, 367
LmnI	GCTCC	1 cut(s)	457
LpnPI	CCDG	6 cut(s)	62, 73, 89, 500, 527, 547
LweI	GCATC	2 cut(s)	46, 257
MaeII	ACGT	1 cut(s)	429
MaeIII	GTNAC	2 cut(s)	163, 425
MboII	GAAGA	2 cut(s)	389, 554
MfeI	CAATTG	1 cut(s)	537
MhlI	GDGCHC	2 cut(s)	83, 371
MlsI	TGGCCA	1 cut(s)	518
MluCI	AATT	4 cut(s)	252, 353, 537, 569
MluNI	TGGCCA	1 cut(s)	518
MlyI	GAGTC	1 cut(s)	152
MmeI	TCCRAC	2 cut(s)	247, 429
MnlI	CCTC	5 cut(s)	111, 138, 398, 461, 533
Mox20I	TGGCCA	1 cut(s)	518
MroXI	GAANNNNTTC	1 cut(s)	396
MscI	TGGCCA	1 cut(s)	518
Msp20I	TGGCCA	1 cut(s)	518
MspR9I	CCNGG	2 cut(s)	77, 515
MunI	CAATTG	1 cut(s)	537
Mva1269I	GAATGC	1 cut(s)	481
MvaI	CCWGG	2 cut(s)	77, 515
MwoI	GCNNNNNNNGC	1 cut(s)	235
NdeI	CATATG	1 cut(s)	94
NlaIII	CATG	2 cut(s)	336, 367
NlaIV	GGNNCC	1 cut(s)	566
NmuCI	GTSAC	2 cut(s)	163, 425
PctI	GAATGC	1 cut(s)	481
PdmI	GAANNNNTTC	1 cut(s)	396
PflFI	GACNNNGTC	1 cut(s)	161
PleI	GAGTC	1 cut(s)	152
PpsI	GAGTC	1 cut(s)	152
Psp6I	CCWGG	2 cut(s)	75, 513
PspFI	CCCAGC	1 cut(s)	561
PspGI	CCWGG	2 cut(s)	75, 513
PspN4I	GGNNCC	1 cut(s)	566
PspPI	GGNCC	3 cut(s)	220, 385, 565
PsyI	GACNNNGTC	1 cut(s)	161
Sau96I	GGNCC	3 cut(s)	220, 385, 565
SchI	GAGTC	1 cut(s)	152
ScrFI	CCNGG	2 cut(s)	77, 515
SduI	GDGCHC	2 cut(s)	83, 371
SfaNI	GCATC	2 cut(s)	46, 257
SfcI	CTRYAG	1 cut(s)	180
SinI	GGWCC	3 cut(s)	220, 385, 565
SmlI	CTYRAG	2 cut(s)	278, 345
SmoI	CTYRAG	2 cut(s)	278, 345
Sse9I	AATT	4 cut(s)	252, 353, 537, 569
StyD4I	CCNGG	2 cut(s)	75, 513
StyI	CCWWGG	1 cut(s)	498
TaiI	ACGT	1 cut(s)	432
TaqI	TCGA	1 cut(s)	390
TasI	AATT	4 cut(s)	252, 353, 537, 569
TseFI	GTSAC	2 cut(s)	163, 425
Tsp45I	GTSAC	2 cut(s)	163, 425
TspDTI	ATGAA	2 cut(s)	257, 274
Tth111I	GACNNNGTC	1 cut(s)	161
VpaK11BI	GGWCC	3 cut(s)	220, 385, 565
XapI	RAATTY	1 cut(s)	353
XmnI	GAANNNNTTC	1 cut(s)	396

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.