Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005319.1

Orthogroup ID

OG0004224

Physical Location & Seq

Genomic Coordinates Reverse (-)

100099 .. 100470

Gene Structure 372 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005319.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

atgaaaattgttcatcgagatgttaaggcaacgaatatactgttggatgagaaacttagggccaaagtgtcggactttggagcttcaaaactggttcttgacgacaaaactcgacgttcaactttaatgcagggcacaatgggatacttggaccccgaatatcttcagtccaacacactaacaaaaaagggtgacgtttatagctttggagttgtcctcatggagctactgacaaacgagaatgcagttcgttttgataaatccaaggcaaagagaaacctggccaacctctttgtttctacaattgaagaaaaaggtctgcgcgcgctgggtccaattcttgatgatgaagtagtcaaggatggaaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 Retrotrans_gag rve zf-H2C2

Protein Analysis

123

Amino Acids

13.78

Weight (kDa)

8.83

Isoelectric Point (pI)

32.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004224)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g10610
malus_domestica	MD05G1270300.v1.1 MD05G1270700.v1.1
rosa_chinensis	RchiOBHm_Chr1g0329511 RchiOBHm_Chr1g0336171 RchiOBHm_Chr5g0016711 RchiOBHm_Chr5g0016781 RchiOBHm_Chr5g0016821 RchiOBHm_Chr5g0017081 RchiOBHm_Chr5g0017111 RchiOBHm_Chr5g0017281 RchiOBHm_Chr5g0017311 RchiOBHm_Chr5g0054731
rosa_laevigata	RLG00000002400 RLG00000023080 RLG00000029879 RLG00000029880
rosa_multiflora	Rmu_sc0000441.1_g000086 Rmu_sc0001235.1_g000006 Rmu_sc0001423.1_g000044 Rmu_sc0003630.1_g000003 Rmu_sc0003801.1_g000025 Rmu_sc0005319.1_g000021 Rmu_sc0005418.1_g000011 Rmu_sc0008053.1_g000024
rosa_roxburghii	Rroxscaffold_1G00012580 Rroxscaffold_1G00013300 Rroxscaffold_4G00321010 Rroxscaffold_6G00395830 Rroxscaffold_6G00395840
rosa_rugosa	Rorug03G0224700
rosa_wichuraiana	Rw3G024380 Rw3G024480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	324, 326
AcoI	YGGCCR	1 cut(s)	282
AcuI	CTGAAG	1 cut(s)	149
AgsI	TTSAA	3 cut(s)	87, 120, 308
AjnI	CCWGG	1 cut(s)	279
AjuI	GAANNNNNNNTTGG	2 cut(s)	26, 58
AluBI	AGCT	3 cut(s)	83, 204, 226
AluI	AGCT	3 cut(s)	83, 204, 226
AoxI	GGCC	2 cut(s)	60, 282
Asp700I	GAANNNNTTC	1 cut(s)	162
AspLEI	GCGC	3 cut(s)	324, 326, 328
AspS9I	GGNCC	3 cut(s)	60, 151, 332
AsuHPI	GGTGA	1 cut(s)	203
AvaII	GGWCC	2 cut(s)	151, 332
BaeGI	GKGCMC	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	284
BccI	CCATC	1 cut(s)	356
BciT130I	CCWGG	1 cut(s)	281
BciVI	GTATCC	1 cut(s)	137
BfaI	CTAG	1 cut(s)	370
BfuI	GTATCC	1 cut(s)	137
Bme1390I	CCNGG	1 cut(s)	281
Bme18I	GGWCC	2 cut(s)	151, 332
BmgT120I	GGNCC	3 cut(s)	60, 151, 332
BmiI	GGNNCC	2 cut(s)	153, 333
BmrFI	CCNGG	1 cut(s)	281
BplI	GAGNNNNNCTC	2 cut(s)	201, 233
BsaJI	CCNNGG	1 cut(s)	264
Bse1I	ACTGG	1 cut(s)	96
BseBI	CCWGG	1 cut(s)	281
BseDI	CCNNGG	1 cut(s)	264
BseGI	GGATG	2 cut(s)	52, 367
BseNI	ACTGG	1 cut(s)	96
BsePI	GCGCGC	2 cut(s)	322, 324
BseSI	GKGCMC	1 cut(s)	137
BseYI	CCCAGC	1 cut(s)	328
Bsh1236I	CGCG	2 cut(s)	324, 326
BshFI	GGCC	2 cut(s)	62, 284
BsmI	GAATGC	1 cut(s)	247
BsnI	GGCC	2 cut(s)	62, 284
Bsp1286I	GDGCHC	1 cut(s)	137
BspANI	GGCC	2 cut(s)	62, 284
BspFNI	CGCG	2 cut(s)	324, 326
BspLI	GGNNCC	2 cut(s)	153, 333
BsrI	ACTGG	1 cut(s)	96
BssECI	CCNNGG	1 cut(s)	264
BssHII	GCGCGC	2 cut(s)	322, 324
BssT1I	CCWWGG	1 cut(s)	264
Bst2UI	CCWGG	1 cut(s)	281
Bst4CI	ACNGT	1 cut(s)	42
BstC8I	GCNNGC	2 cut(s)	324, 326
BstDEI	CTNAG	1 cut(s)	56
BstF5I	GGATG	2 cut(s)	52, 367
BstFNI	CGCG	2 cut(s)	324, 326
BstHHI	GCGC	3 cut(s)	324, 326, 328
BstNI	CCWGG	1 cut(s)	281
BstSCI	CCNGG	1 cut(s)	279
BstSLI	GKGCMC	1 cut(s)	137
BstUI	CGCG	2 cut(s)	324, 326
BsuI	GTATCC	1 cut(s)	137
BsuRI	GGCC	2 cut(s)	62, 284
BtsCI	GGATG	2 cut(s)	52, 367
Cac8I	GCNNGC	2 cut(s)	324, 326
CfoI	GCGC	3 cut(s)	324, 326, 328
Cfr13I	GGNCC	3 cut(s)	60, 151, 332
CviAII	CATG	1 cut(s)	220
CviJI	RGCY	5 cut(s)	62, 83, 204, 226, 284
CviKI_1	RGCY	5 cut(s)	62, 83, 204, 226, 284
DdeI	CTNAG	1 cut(s)	56
EaeI	YGGCCR	1 cut(s)	282
Eco130I	CCWWGG	1 cut(s)	264
Eco47I	GGWCC	2 cut(s)	151, 332
Eco57I	CTGAAG	1 cut(s)	149
EcoRII	CCWGG	1 cut(s)	279
EcoT14I	CCWWGG	1 cut(s)	264
ErhI	CCWWGG	1 cut(s)	264
FaeI	CATG	1 cut(s)	223
FaiI	YATR	3 cut(s)	38, 201, 221
FatI	CATG	1 cut(s)	219
FokI	GGATG	1 cut(s)	59
FspBI	CTAG	1 cut(s)	370
GlaI	GCGC	3 cut(s)	323, 325, 327
GsaI	CCCAGC	1 cut(s)	332
HaeIII	GGCC	2 cut(s)	62, 284
HhaI	GCGC	3 cut(s)	324, 326, 328
Hin1II	CATG	1 cut(s)	223
Hin6I	GCGC	3 cut(s)	322, 324, 326
HinP1I	GCGC	3 cut(s)	322, 324, 326
HphI	GGTGA	1 cut(s)	203
Hpy188I	TCNGA	1 cut(s)	73
Hpy188III	TCNNGA	3 cut(s)	17, 98, 341
Hpy99I	CGWCG	1 cut(s)	117
HpyCH4III	ACNGT	1 cut(s)	42
HpyCH4IV	ACGT	2 cut(s)	115, 195
HpyCH4V	TGCA	2 cut(s)	130, 245
HpyF3I	CTNAG	1 cut(s)	56
HpySE526I	ACGT	2 cut(s)	115, 195
Hsp92II	CATG	1 cut(s)	223
HspAI	GCGC	3 cut(s)	322, 324, 326
LmnI	GCTCC	2 cut(s)	80, 223
LpnPI	CCDG	5 cut(s)	77, 116, 266, 293, 314
MaeI	CTAG	1 cut(s)	370
MaeII	ACGT	2 cut(s)	115, 195
MaeIII	GTNAC	1 cut(s)	191
MboII	GAAGA	2 cut(s)	155, 320
MfeI	CAATTG	1 cut(s)	303
MhlI	GDGCHC	1 cut(s)	137
MlsI	TGGCCA	1 cut(s)	284
MluCI	AATT	3 cut(s)	6, 303, 336
MluNI	TGGCCA	1 cut(s)	284
MmeI	TCCRAC	3 cut(s)	24, 51, 195
MnlI	CCTC	2 cut(s)	227, 299
Mox20I	TGGCCA	1 cut(s)	284
MroXI	GAANNNNTTC	1 cut(s)	162
MscI	TGGCCA	1 cut(s)	284
MseI	TTAA	2 cut(s)	24, 125
MslI	CAYNNNNRTG	1 cut(s)	18
Msp20I	TGGCCA	1 cut(s)	284
MspR9I	CCNGG	1 cut(s)	281
MunI	CAATTG	1 cut(s)	303
Mva1269I	GAATGC	1 cut(s)	247
MvaI	CCWGG	1 cut(s)	281
MvnI	CGCG	2 cut(s)	324, 326
NlaIII	CATG	1 cut(s)	223
NlaIV	GGNNCC	2 cut(s)	153, 333
NmuCI	GTSAC	1 cut(s)	191
PauI	GCGCGC	2 cut(s)	322, 324
PctI	GAATGC	1 cut(s)	247
PdmI	GAANNNNTTC	1 cut(s)	162
Psp6I	CCWGG	1 cut(s)	279
PspFI	CCCAGC	1 cut(s)	328
PspGI	CCWGG	1 cut(s)	279
PspN4I	GGNNCC	2 cut(s)	153, 333
PspPI	GGNCC	3 cut(s)	60, 151, 332
PteI	GCGCGC	2 cut(s)	322, 324
RseI	CAYNNNNRTG	1 cut(s)	18
SaqAI	TTAA	2 cut(s)	24, 125
Sau96I	GGNCC	3 cut(s)	60, 151, 332
ScrFI	CCNGG	1 cut(s)	281
SduI	GDGCHC	1 cut(s)	137
SetI	ASST	8 cut(s)	85, 118, 198, 206, 228, 282, 291, 319
SinI	GGWCC	2 cut(s)	151, 332
SmiMI	CAYNNNNRTG	1 cut(s)	18
Sse9I	AATT	3 cut(s)	6, 303, 336
SspMI	CTAG	1 cut(s)	370
StyD4I	CCNGG	1 cut(s)	279
StyI	CCWWGG	1 cut(s)	264
TaaI	ACNGT	1 cut(s)	42
TaiI	ACGT	2 cut(s)	118, 198
TaqI	TCGA	2 cut(s)	16, 112
TasI	AATT	3 cut(s)	6, 303, 336
Tru1I	TTAA	2 cut(s)	24, 125
Tru9I	TTAA	2 cut(s)	24, 125
TseFI	GTSAC	1 cut(s)	191
Tsp45I	GTSAC	1 cut(s)	191
TspDTI	ATGAA	2 cut(s)	17, 363
VpaK11BI	GGWCC	2 cut(s)	151, 332
XmnI	GAANNNNTTC	1 cut(s)	162
XspI	CTAG	1 cut(s)	370

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.