MD07G1250100.v1.1

cyclin-D1-binding protein 1 homolog

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
31878068 .. 31887488
9421 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1250100.v1.1.491

Sequence Viewer

Length: 147 bp
ATGTTCCCAGCAGGCTTCCTCTCGCCGTCTCCACAACCCACTTCGCCCAGCTCGATTCACCGTCTCAACCACCACCTCAACATCGACCACGAGACCTTCCAGGTGTTAGATCAAACTGTACCTTCAACCCTCGAGAAGGTGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.36

Weight (kDa)

5.98

Isoelectric Point (pI)

84.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 126
AjnI CCWGG 1 cut(s) 99
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
Alw26I GTCTC 3 cut(s) 33, 68, 86
Ama87I CYCGRG 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 50
AvaI CYCGRG 1 cut(s) 131
BauI CACGAG 1 cut(s) 89
BceAI ACGGC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 101
BcoDI GTCTC 3 cut(s) 33, 68, 86
BfaI CTAG 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 101
BmeT110I CYCGRG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 101
BsaI GGTCTC 1 cut(s) 86
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 136
BseYI CCCAGC 2 cut(s) 7, 47
BsiHKCI CYCGRG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 136
BsmAI GTCTC 3 cut(s) 33, 68, 86
BsmBI CGTCTC 2 cut(s) 33, 68
Bso31I GGTCTC 1 cut(s) 86
BsoBI CYCGRG 1 cut(s) 131
Bsp143I GATC 2 cut(s) 109, 141
BspTNI GGTCTC 1 cut(s) 86
BssMI GATC 2 cut(s) 109, 141
BssSI CACGAG 1 cut(s) 89
Bst2BI CACGAG 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 101
Bst4CI ACNGT 2 cut(s) 62, 118
BstC8I GCNNGC 1 cut(s) 13
BstENI CCTNNNNNAGG 1 cut(s) 134
BstKTI GATC 2 cut(s) 112, 144
BstMAI GTCTC 3 cut(s) 33, 68, 86
BstMBI GATC 2 cut(s) 109, 141
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 13
Csp6I GTAC 1 cut(s) 119
CviJI RGCY 2 cut(s) 15, 51
CviKI_1 RGCY 2 cut(s) 15, 51
CviQI GTAC 1 cut(s) 119
DpnI GATC 2 cut(s) 111, 143
DpnII GATC 2 cut(s) 109, 141
Eco31I GGTCTC 1 cut(s) 86
Eco88I CYCGRG 1 cut(s) 131
EcoNI CCTNNNNNAGG 1 cut(s) 134
EcoRII CCWGG 1 cut(s) 99
Esp3I CGTCTC 2 cut(s) 33, 68
FspBI CTAG 1 cut(s) 145
GsaI CCCAGC 2 cut(s) 11, 51
HinfI GANTC 1 cut(s) 55
HphI GGTGA 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 133
HpyAV CCTTC 3 cut(s) 106, 130, 132
HpyCH4III ACNGT 2 cut(s) 62, 118
Kzo9I GATC 2 cut(s) 109, 141
LpnPI CCDG 4 cut(s) 21, 61, 86, 113
MaeI CTAG 1 cut(s) 145
MalI GATC 2 cut(s) 111, 143
MboI GATC 2 cut(s) 109, 141
MnlI CCTC 3 cut(s) 29, 86, 140
MspR9I CCNGG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 101
NdeII GATC 2 cut(s) 109, 141
PaeR7I CTCGAG 1 cut(s) 131
PcsI WCGNNNNNNNCGW 1 cut(s) 50
PfeI GAWTC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 99
PspFI CCCAGC 2 cut(s) 7, 47
PspGI CCWGG 1 cut(s) 99
RsaI GTAC 1 cut(s) 120
RsaNI GTAC 1 cut(s) 119
Sau3AI GATC 2 cut(s) 109, 141
ScrFI CCNGG 1 cut(s) 101
SetI ASST 6 cut(s) 53, 78, 98, 105, 124, 141
Sfr274I CTCGAG 1 cut(s) 131
SlaI CTCGAG 1 cut(s) 131
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
SspMI CTAG 1 cut(s) 145
StyD4I CCNGG 1 cut(s) 99
TaaI ACNGT 2 cut(s) 62, 118
TaqI TCGA 3 cut(s) 53, 84, 132
TfiI GAWTC 1 cut(s) 55
XagI CCTNNNNNAGG 1 cut(s) 134
XhoI CTCGAG 1 cut(s) 131
XspI CTAG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.