MD08G1170900.v1.1

UPF0695 membrane protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
20524610 .. 20526803
2194 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1170900.v1.1.491

Sequence Viewer

Length: 312 bp
ATGCTCTTGCAGGTTGGGATTCTGTTTGTCTTCTTGACAAAATTGAATGTCATTGTAACCAATGGCGAAGCCACATTAAGGGTTATCCTGGGCTATAGCCCAGGTTGGTTCTTTCTTGATGGGGTGGTTGGGTGTTGTTTTCGAAGGAGATATATCCTATACGTCCGATTATTTGCCATTGGATTGTCAGCCGGTTACATAGGAAGCCTTACAACTTTCAGCTGTTGGAAGCAGAAAATGCTTGAACTCAGTGCTGAAGGCCATTGGATGTTCGCTCTGCTCGGTTTTCTAATAGGTAATATGTCATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.58

Weight (kDa)

9.26

Isoelectric Point (pI)

43.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 310
AcuI CTGAAG 1 cut(s) 276
AfiI CCNNNNNNNGG 1 cut(s) 78
AgsI TTSAA 2 cut(s) 46, 245
AjnI CCWGG 2 cut(s) 87, 100
AluBI AGCT 1 cut(s) 222
AluI AGCT 1 cut(s) 222
AoxI GGCC 1 cut(s) 259
AsuII TTCGAA 1 cut(s) 142
BbsI GAAGAC 1 cut(s) 22
BccI CCATC 1 cut(s) 113
BciT130I CCWGG 2 cut(s) 89, 102
BfmI CTRYAG 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 89, 102
BmrFI CCNGG 2 cut(s) 89, 102
BpiI GAAGAC 1 cut(s) 22
Bpu14I TTCGAA 1 cut(s) 142
BsaJI CCNNGG 2 cut(s) 88, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 78
Bse118I RCCGGY 1 cut(s) 191
BseBI CCWGG 2 cut(s) 89, 102
BseDI CCNNGG 2 cut(s) 88, 100
BseGI GGATG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 262
BshFI GGCC 1 cut(s) 261
BsiSI CCGG 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 78
BsnI GGCC 1 cut(s) 261
Bsp119I TTCGAA 1 cut(s) 142
BspANI GGCC 1 cut(s) 261
BspCNI CTCAG 1 cut(s) 261
BspT104I TTCGAA 1 cut(s) 142
BsrFI RCCGGY 1 cut(s) 191
BssAI RCCGGY 1 cut(s) 191
BssECI CCNNGG 2 cut(s) 88, 100
Bst2UI CCWGG 2 cut(s) 89, 102
BstAPI GCANNNNNTGC 1 cut(s) 238
BstBI TTCGAA 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 248
BstF5I GGATG 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 238
BstNI CCWGG 2 cut(s) 89, 102
BstSCI CCNGG 2 cut(s) 87, 100
BstSFI CTRYAG 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 22
BsuRI GGCC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 256
Cfr10I RCCGGY 1 cut(s) 191
CviJI RGCY 7 cut(s) 71, 93, 99, 191, 207, 222, 261
CviKI_1 RGCY 7 cut(s) 71, 93, 99, 191, 207, 222, 261
DdeI CTNAG 1 cut(s) 248
Eco57I CTGAAG 1 cut(s) 276
EcoRII CCWGG 2 cut(s) 87, 100
FaiI YATR 6 cut(s) 96, 153, 160, 200, 302, 310
FokI GGATG 1 cut(s) 280
HaeIII GGCC 1 cut(s) 261
HapII CCGG 1 cut(s) 192
HinfI GANTC 1 cut(s) 19
HpaII CCGG 1 cut(s) 192
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 34, 116
HpyAV CCTTC 2 cut(s) 138, 251
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 238
HpyF3I CTNAG 1 cut(s) 248
HpySE526I ACGT 1 cut(s) 162
LpnPI CCDG 5 cut(s) 74, 87, 101, 114, 205
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 2 cut(s) 55, 194
MboII GAAGA 1 cut(s) 22
MluCI AATT 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 206
MseI TTAA 1 cut(s) 77
MspA1I CMGCKG 1 cut(s) 222
MspI CCGG 1 cut(s) 192
MspR9I CCNGG 2 cut(s) 89, 102
MvaI CCWGG 2 cut(s) 89, 102
MwoI GCNNNNNNNGC 1 cut(s) 238
NspV TTCGAA 1 cut(s) 142
PfeI GAWTC 1 cut(s) 19
PsiI TTATAA 1 cut(s) 310
Psp6I CCWGG 2 cut(s) 87, 100
PspGI CCWGG 2 cut(s) 87, 100
PvuII CAGCTG 1 cut(s) 222
SaqAI TTAA 1 cut(s) 77
ScrFI CCNGG 2 cut(s) 89, 102
SetI ASST 5 cut(s) 15, 106, 165, 224, 298
SfcI CTRYAG 1 cut(s) 94
SfuI TTCGAA 1 cut(s) 142
Sse9I AATT 1 cut(s) 41
StyD4I CCNGG 2 cut(s) 87, 100
TaiI ACGT 1 cut(s) 165
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 41
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TscAI CASTG 1 cut(s) 256
TspRI CASTG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.