MD11G1207600.v1.1

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
30246710 .. 30248001
1292 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1207600.v1.1.491

Sequence Viewer

Length: 219 bp
ATGTTGGCCAATATATATGGGCAGTTGGGGAAGTGGGATGATGTCCGAAACGTGAGAAAGATGCTGAGGGAGCGAAATGCTTATAAAACCCCAGGTTGCAGTTGGATTGAGGTTGATAATCAAGTTTACCAATTTTATTCAATTGACAAATCACATCCTAGAACGGAAGAGATCTACCAAATCCTAGACATTCTCCTCTTATTTCTTCCCGACATATGA

Protein Analysis

73

Amino Acids

8.63

Weight (kDa)

5.67

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
E_motif PF20431 1 - 37 1.9e-11 E motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 84
AcoI YGGCCR 1 cut(s) 6
AgsI TTSAA 1 cut(s) 141
AjnI CCWGG 1 cut(s) 91
AoxI GGCC 1 cut(s) 6
BalI TGGCCA 1 cut(s) 8
BbvCI CCTCAGC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 93
BfaI CTAG 2 cut(s) 159, 185
BglII AGATCT 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 91
BseGI GGATG 2 cut(s) 43, 154
BseMII CTCAG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 185
BshFI GGCC 1 cut(s) 8
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 171
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 93
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 2 cut(s) 43, 154
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 171
BstYI RGATCY 1 cut(s) 171
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 2 cut(s) 43, 154
CviJI RGCY 1 cut(s) 8
CviKI_1 RGCY 1 cut(s) 8
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
EaeI YGGCCR 1 cut(s) 6
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 91
FaiI YATR 6 cut(s) 14, 16, 18, 84, 215, 217
FauNDI CATATG 1 cut(s) 215
FokI GGATG 2 cut(s) 50, 141
FspBI CTAG 2 cut(s) 159, 185
HaeIII GGCC 1 cut(s) 8
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 47
Hpy188III TCNNGA 1 cut(s) 209
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 65
HpySE526I ACGT 1 cut(s) 51
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 2 cut(s) 78, 105
LweI GCATC 1 cut(s) 51
MaeI CTAG 2 cut(s) 159, 185
MaeII ACGT 1 cut(s) 51
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 2 cut(s) 179, 197
MfeI CAATTG 1 cut(s) 141
MflI RGATCY 1 cut(s) 171
MlsI TGGCCA 1 cut(s) 8
MluCI AATT 2 cut(s) 131, 141
MluNI TGGCCA 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 3 cut(s) 60, 103, 206
Mox20I TGGCCA 1 cut(s) 8
MscI TGGCCA 1 cut(s) 8
Msp20I TGGCCA 1 cut(s) 8
MspR9I CCNGG 1 cut(s) 93
MunI CAATTG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 70
NdeI CATATG 1 cut(s) 215
NdeII GATC 1 cut(s) 171
PsiI TTATAA 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PsuI RGATCY 1 cut(s) 171
Sau3AI GATC 1 cut(s) 171
ScrFI CCNGG 1 cut(s) 93
SetI ASST 3 cut(s) 54, 97, 114
SfaNI GCATC 1 cut(s) 51
SgeI CNNG 6 cut(s) 64, 104, 105, 134, 171, 197
Sse9I AATT 2 cut(s) 131, 141
SspMI CTAG 2 cut(s) 159, 185
StyD4I CCNGG 1 cut(s) 91
TaiI ACGT 1 cut(s) 54
TasI AATT 2 cut(s) 131, 141
TspGWI ACGGA 1 cut(s) 179
XcmI CCANNNNNNNNNTGG 1 cut(s) 99
XspI CTAG 2 cut(s) 159, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.