Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8368077.1

Orthogroup ID

OG0004368

Physical Location & Seq

Genomic Coordinates Reverse (-)

602 .. 1000

Gene Structure 399 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8368077.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

atgcctattgaaccagatgcatctgtgtggagggctttgctcaatggttgtcgagttaattctgcgcctgagttagctggagcaatctttgagaaacttgtggaattagaacccatgaatgcagggaattatgttctgctatctaatatatatgctgcagcaggtctatggttagaggtcaggaagataagaacattgctgtgggaaaagggtttgaaaaagcctccaggaacaagctggattgttattaaaagtcaggtccactcttttgttgcctcagacacatcacaccttgattcaaacagaatttatgcttgtttaaattctctgtcagccttaatcaaagaaattggttatactcctgatcttcaatgggttttgcatgaagaggaaaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

132

Amino Acids

14.75

Weight (kDa)

5.58

Isoelectric Point (pI)

38.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004368)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G46050
fragaria_vesca	FvH4_7g14820
malus_domestica	MD01G1066700.v1.1 MD11G1207600.v1.1
pyrus_communis	pycom01g09600 pycom01g22640 pycom17g24510
rosa_chinensis	RchiOBHm_Chr1g0356771 RchiOBHm_Chr1g0356781 RchiOBHm_Chr1g0375691 RchiOBHm_Chr2g0089631 RchiOBHm_Chr4g0418871
rosa_laevigata	RLG00000011901 RLG00000028084
rosa_multiflora	Rmu_co8104928.1_g000001 Rmu_co8368077.1_g000001 Rmu_sc0000517.1_g000030 Rmu_sc0000935.1_g000021 Rmu_sc0002219.1_g000014 Rmu_sc0005718.1_g000009
rosa_roxburghii	Rroxscaffold_4G00299370
rosa_rugosa	Rorug01G0251100
rosa_samantha	Rh1AG265300 Rh1AG265400 Rh1BG232700 Rh1BG232800 Rh1CG248800 Rh1CG248900 Rh1DG260300 Rh4BG214000 Rh6AG008500
rosa_wichuraiana	Rw4G018520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	152
AcsI	RAATTY	2 cut(s)	306, 322
AgsI	TTSAA	4 cut(s)	11, 217, 300, 371
AjnI	CCWGG	1 cut(s)	226
AluBI	AGCT	2 cut(s)	77, 237
AluI	AGCT	2 cut(s)	77, 237
ApeKI	GCWGC	2 cut(s)	155, 158
ApoI	RAATTY	2 cut(s)	306, 322
AspLEI	GCGC	1 cut(s)	67
AspS9I	GGNCC	1 cut(s)	259
AvaII	GGWCC	1 cut(s)	259
BbvI	GCAGC	2 cut(s)	142, 170
BciT130I	CCWGG	1 cut(s)	228
BfmI	CTRYAG	1 cut(s)	156
BfuAI	ACCTGC	1 cut(s)	152
BisI	GCNGC	2 cut(s)	156, 159
BlsI	GCNGC	2 cut(s)	157, 160
Bme1390I	CCNGG	1 cut(s)	228
Bme18I	GGWCC	1 cut(s)	259
BmgT120I	GGNCC	1 cut(s)	259
BmrFI	CCNGG	1 cut(s)	228
BmsI	GCATC	2 cut(s)	7, 29
BpmI	CTGGAG	2 cut(s)	99, 210
Bse3DI	GCAATG	1 cut(s)	194
BseBI	CCWGG	1 cut(s)	228
BseMI	GCAATG	1 cut(s)	194
BseMII	CTCAG	2 cut(s)	60, 291
BseXI	GCAGC	2 cut(s)	142, 170
BsmI	GAATGC	1 cut(s)	124
Bsp143I	GATC	1 cut(s)	364
BspCNI	CTCAG	2 cut(s)	61, 290
BspMAI	CTGCAG	1 cut(s)	160
BspMI	ACCTGC	1 cut(s)	152
BsrDI	GCAATG	1 cut(s)	194
BssMI	GATC	1 cut(s)	364
Bst2UI	CCWGG	1 cut(s)	228
Bst6I	CTCTTC	1 cut(s)	381
BstDEI	CTNAG	2 cut(s)	69, 277
BstHHI	GCGC	1 cut(s)	67
BstKTI	GATC	1 cut(s)	367
BstMBI	GATC	1 cut(s)	364
BstNI	CCWGG	1 cut(s)	228
BstSCI	CCNGG	1 cut(s)	226
BstSFI	CTRYAG	1 cut(s)	156
BstV1I	GCAGC	2 cut(s)	142, 170
BveI	ACCTGC	1 cut(s)	152
CfoI	GCGC	1 cut(s)	67
Cfr13I	GGNCC	1 cut(s)	259
CviAII	CATG	2 cut(s)	115, 383
CviJI	RGCY	5 cut(s)	35, 77, 223, 237, 335
CviKI_1	RGCY	5 cut(s)	35, 77, 223, 237, 335
DdeI	CTNAG	2 cut(s)	69, 277
DpnI	GATC	1 cut(s)	366
DpnII	GATC	1 cut(s)	364
DraI	TTTAAA	1 cut(s)	321
Eam1104I	CTCTTC	1 cut(s)	381
EarI	CTCTTC	1 cut(s)	381
Eco47I	GGWCC	1 cut(s)	259
EcoRII	CCWGG	1 cut(s)	226
EcoT22I	ATGCAT	1 cut(s)	22
FaeI	CATG	2 cut(s)	118, 386
FaiI	YATR	9 cut(s)	116, 132, 149, 151, 153, 169, 312, 357, 384
FatI	CATG	2 cut(s)	114, 382
Fnu4HI	GCNGC	2 cut(s)	156, 159
Fsp4HI	GCNGC	2 cut(s)	156, 159
GlaI	GCGC	1 cut(s)	66
GluI	GCNGC	2 cut(s)	156, 159
GsuI	CTGGAG	2 cut(s)	99, 210
HhaI	GCGC	1 cut(s)	67
Hin1II	CATG	2 cut(s)	118, 386
Hin6I	GCGC	1 cut(s)	65
HinP1I	GCGC	1 cut(s)	65
HinfI	GANTC	1 cut(s)	296
Hpy166II	GTNNAC	1 cut(s)	262
Hpy188I	TCNGA	1 cut(s)	280
Hpy188III	TCNNGA	2 cut(s)	181, 362
Hpy8I	GTNNAC	1 cut(s)	262
HpyCH4V	TGCA	4 cut(s)	20, 122, 158, 382
HpyF3I	CTNAG	2 cut(s)	69, 277
Hsp92II	CATG	2 cut(s)	118, 386
HspAI	GCGC	1 cut(s)	65
Kzo9I	GATC	1 cut(s)	364
LmnI	GCTCC	1 cut(s)	80
Lsp1109I	GCAGC	2 cut(s)	142, 170
LweI	GCATC	2 cut(s)	7, 29
MalI	GATC	1 cut(s)	366
MboI	GATC	1 cut(s)	364
MboII	GAAGA	3 cut(s)	196, 359, 398
MluCI	AATT	7 cut(s)	58, 104, 127, 306, 322, 348, 394
MnlI	CCTC	5 cut(s)	24, 169, 234, 286, 382
Mph1103I	ATGCAT	1 cut(s)	22
MseI	TTAA	5 cut(s)	57, 249, 320, 338, 397
MslI	CAYNNNNRTG	2 cut(s)	25, 199
MspR9I	CCNGG	1 cut(s)	228
Mva1269I	GAATGC	1 cut(s)	124
MvaI	CCWGG	1 cut(s)	228
NdeII	GATC	1 cut(s)	364
NlaIII	CATG	2 cut(s)	118, 386
NsiI	ATGCAT	1 cut(s)	22
PctI	GAATGC	1 cut(s)	124
PfeI	GAWTC	1 cut(s)	296
PfoI	TCCNGGA	1 cut(s)	226
PkrI	GCNGC	2 cut(s)	157, 160
Psp6I	CCWGG	1 cut(s)	226
PspGI	CCWGG	1 cut(s)	226
PspPI	GGNCC	1 cut(s)	259
PstI	CTGCAG	1 cut(s)	160
RseI	CAYNNNNRTG	2 cut(s)	25, 199
SaqAI	TTAA	5 cut(s)	57, 249, 320, 338, 397
SatI	GCNGC	2 cut(s)	156, 159
Sau3AI	GATC	1 cut(s)	364
Sau96I	GGNCC	1 cut(s)	259
ScrFI	CCNGG	1 cut(s)	228
SetI	ASST	6 cut(s)	79, 166, 180, 239, 261, 294
SfaNI	GCATC	2 cut(s)	7, 29
SfcI	CTRYAG	1 cut(s)	156
SinI	GGWCC	1 cut(s)	259
SmiMI	CAYNNNNRTG	2 cut(s)	25, 199
Sse9I	AATT	7 cut(s)	58, 104, 127, 306, 322, 348, 394
StyD4I	CCNGG	1 cut(s)	226
TaqI	TCGA	1 cut(s)	52
TasI	AATT	7 cut(s)	58, 104, 127, 306, 322, 348, 394
TfiI	GAWTC	1 cut(s)	296
Tru1I	TTAA	5 cut(s)	57, 249, 320, 338, 397
Tru9I	TTAA	5 cut(s)	57, 249, 320, 338, 397
TseI	GCWGC	2 cut(s)	155, 158
TspDTI	ATGAA	2 cut(s)	131, 399
VpaK11BI	GGWCC	1 cut(s)	259
XapI	RAATTY	2 cut(s)	306, 322
XcmI	CCANNNNNNNNNTGG	1 cut(s)	234
Zsp2I	ATGCAT	1 cut(s)	22

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.