Rmu_sc0000935.1_g000021

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000935.1
Physical Location & Seq
Forward (+)
106212 .. 106833
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000935.1_g000021.1.cds

Sequence Viewer

Length: 435 bp
atggcttctgggtatgtgaaatctggtgacttggacaatgcacgccagatgtttgataaaatgctgagaggttgtgtctcgtatactactatgataatgggtctttctagaaatgggttttggagggaagctgttgaggcttttagggatatgaggaatgccggtagctggcagagtagaagcatgtccatgaaggcagatgttgtgatatggggcacattattggccacaagtacaacacatgggaatctagaaataggagaaatggctgaaaagaatttgaaactgttggatccatctcatggggcaagtacggttctcatgtccaacctacttgcagatgcagggaagtgggaggaagcctctttggaaaggcgagtaatgcagagcctaagactaacgagatcaccagggcacagtgatgttgtttggtaa

Protein Analysis

144

Amino Acids

16.05

Weight (kDa)

7.92

Isoelectric Point (pI)

40.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 302
AccI GTMKAC 1 cut(s) 83
AclWI GGATC 2 cut(s) 287, 300
AcoI YGGCCR 1 cut(s) 225
AcsI RAATTY 1 cut(s) 277
AfaI GTAC 2 cut(s) 235, 313
AfiI CCNNNNNNNGG 2 cut(s) 168, 302
AgsI TTSAA 1 cut(s) 283
AjnI CCWGG 1 cut(s) 409
AjuI GAANNNNNNNTTGG 2 cut(s) 103, 135
AluBI AGCT 2 cut(s) 131, 168
AluI AGCT 2 cut(s) 131, 168
Alw26I GTCTC 1 cut(s) 82
AlwI GGATC 2 cut(s) 287, 300
AoxI GGCC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 277
AsuHPI GGTGA 2 cut(s) 38, 399
BaeGI GKGCMC 2 cut(s) 218, 417
BalI TGGCCA 1 cut(s) 227
BamHI GGATCC 1 cut(s) 292
BccI CCATC 1 cut(s) 304
BciT130I CCWGG 1 cut(s) 411
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 2 cut(s) 108, 251
Bme1390I CCNGG 1 cut(s) 411
BmiI GGNNCC 1 cut(s) 294
BmrFI CCNGG 1 cut(s) 411
BmsI GCATC 1 cut(s) 331
BplI GAGNNNNNCTC 2 cut(s) 347, 379
BsaJI CCNNGG 1 cut(s) 410
Bsc4I CCNNNNNNNGG 2 cut(s) 168, 302
Bse118I RCCGGY 1 cut(s) 161
BseBI CCWGG 1 cut(s) 411
BseDI CCNNGG 1 cut(s) 410
BseLI CCNNNNNNNGG 2 cut(s) 168, 302
BseMII CTCAG 1 cut(s) 56
BseSI GKGCMC 2 cut(s) 218, 417
BshFI GGCC 1 cut(s) 227
BsiSI CCGG 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 168, 302
BsmAI GTCTC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 227
Bsp1286I GDGCHC 2 cut(s) 218, 417
Bsp143I GATC 2 cut(s) 292, 404
BspANI GGCC 1 cut(s) 227
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 294
BspPI GGATC 2 cut(s) 287, 300
BsrFI RCCGGY 1 cut(s) 161
BssAI RCCGGY 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 410
BssMI GATC 2 cut(s) 292, 404
BssNAI GTATAC 1 cut(s) 84
Bst1107I GTATAC 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 411
Bst4CI ACNGT 3 cut(s) 288, 316, 419
BstC8I GCNNGC 2 cut(s) 43, 170
BstDEI CTNAG 2 cut(s) 65, 392
BstKTI GATC 2 cut(s) 295, 407
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 2 cut(s) 292, 404
BstMWI GCNNNNNNNGC 2 cut(s) 137, 382
BstNI CCWGG 1 cut(s) 411
BstNSI RCATGY 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 409
BstSLI GKGCMC 2 cut(s) 218, 417
BstX2I RGATCY 1 cut(s) 292
BstYI RGATCY 1 cut(s) 292
BstZ17I GTATAC 1 cut(s) 84
BsuRI GGCC 1 cut(s) 227
BtsIMutI CAGTG 1 cut(s) 424
Cac8I GCNNGC 2 cut(s) 43, 170
Cfr10I RCCGGY 1 cut(s) 161
Csp6I GTAC 2 cut(s) 234, 312
CviAII CATG 5 cut(s) 184, 190, 242, 302, 322
CviJI RGCY 8 cut(s) 5, 131, 140, 168, 227, 269, 362, 390
CviKI_1 RGCY 8 cut(s) 5, 131, 140, 168, 227, 269, 362, 390
CviQI GTAC 2 cut(s) 234, 312
DdeI CTNAG 2 cut(s) 65, 392
DpnI GATC 2 cut(s) 294, 406
DpnII GATC 2 cut(s) 292, 404
EaeI YGGCCR 1 cut(s) 225
EcoRII CCWGG 1 cut(s) 409
FaeI CATG 5 cut(s) 187, 193, 245, 305, 325
FatI CATG 5 cut(s) 183, 189, 241, 301, 321
FblI GTMKAC 1 cut(s) 83
FspBI CTAG 2 cut(s) 108, 251
HaeIII GGCC 1 cut(s) 227
HapII CCGG 1 cut(s) 162
Hin1II CATG 5 cut(s) 187, 193, 245, 305, 325
HinfI GANTC 1 cut(s) 247
HpaII CCGG 1 cut(s) 162
HphI GGTGA 2 cut(s) 38, 399
Hpy166II GTNNAC 1 cut(s) 84
Hpy188III TCNNGA 2 cut(s) 108, 251
Hpy8I GTNNAC 1 cut(s) 84
HpyAV CCTTC 1 cut(s) 187
HpyCH4III ACNGT 3 cut(s) 288, 316, 419
HpyCH4V TGCA 4 cut(s) 41, 338, 344, 385
HpyF10VI GCNNNNNNNGC 2 cut(s) 137, 382
HpyF3I CTNAG 2 cut(s) 65, 392
Hsp92II CATG 5 cut(s) 187, 193, 245, 305, 325
Kzo9I GATC 2 cut(s) 292, 404
LpnPI CCDG 7 cut(s) 9, 59, 154, 175, 330, 396, 423
LweI GCATC 1 cut(s) 331
MaeI CTAG 2 cut(s) 108, 251
MaeIII GTNAC 1 cut(s) 26
MalI GATC 2 cut(s) 294, 406
MboI GATC 2 cut(s) 292, 404
MflI RGATCY 1 cut(s) 292
MhlI GDGCHC 2 cut(s) 218, 417
MlsI TGGCCA 1 cut(s) 227
MluCI AATT 1 cut(s) 277
MluNI TGGCCA 1 cut(s) 227
MmeI TCCRAC 2 cut(s) 270, 351
MnlI CCTC 6 cut(s) 62, 117, 130, 147, 349, 373
Mox20I TGGCCA 1 cut(s) 227
MscI TGGCCA 1 cut(s) 227
MslI CAYNNNNRTG 2 cut(s) 188, 420
Msp20I TGGCCA 1 cut(s) 227
MspI CCGG 1 cut(s) 162
MspR9I CCNGG 1 cut(s) 411
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 1 cut(s) 411
MwoI GCNNNNNNNGC 2 cut(s) 137, 382
NdeII GATC 2 cut(s) 292, 404
NlaIII CATG 5 cut(s) 187, 193, 245, 305, 325
NlaIV GGNNCC 1 cut(s) 294
NmuCI GTSAC 1 cut(s) 26
NspI RCATGY 1 cut(s) 187
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 247
PflMI CCANNNNNTGG 1 cut(s) 302
Psp6I CCWGG 1 cut(s) 409
PspGI CCWGG 1 cut(s) 409
PspN4I GGNNCC 1 cut(s) 294
PsuI RGATCY 1 cut(s) 292
RsaI GTAC 2 cut(s) 235, 313
RsaNI GTAC 2 cut(s) 234, 312
RseI CAYNNNNRTG 2 cut(s) 188, 420
Sau3AI GATC 2 cut(s) 292, 404
ScrFI CCNGG 1 cut(s) 411
SduI GDGCHC 2 cut(s) 218, 417
SetI ASST 4 cut(s) 73, 133, 170, 333
SfaNI GCATC 1 cut(s) 331
SmiMI CAYNNNNRTG 2 cut(s) 188, 420
Sse9I AATT 1 cut(s) 277
SspMI CTAG 2 cut(s) 108, 251
StyD4I CCNGG 1 cut(s) 409
TaaI ACNGT 3 cut(s) 288, 316, 419
TasI AATT 1 cut(s) 277
TatI WGTACW 1 cut(s) 233
TfiI GAWTC 1 cut(s) 247
TscAI CASTG 1 cut(s) 424
TseFI GTSAC 1 cut(s) 26
Tsp45I GTSAC 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 206
TspRI CASTG 1 cut(s) 424
Van91I CCANNNNNTGG 1 cut(s) 302
XapI RAATTY 1 cut(s) 277
XbaI TCTAGA 2 cut(s) 107, 250
XceI RCATGY 1 cut(s) 187
XmiI GTMKAC 1 cut(s) 83
XspI CTAG 2 cut(s) 108, 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.