RchiOBHm_Chr1g0375691

Pentatricopeptide repeat-containing protein At5g66520-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
63022646 .. 63024158
1513 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59939

Sequence Viewer

Length: 180 bp
ATGTGGTCGAAGAAACGTGTTTACTTTATTCAACCACAGCTTTATCACTACGCATGCATTTTTGACTTACTTAGGCAGGCCAGGCTAATTGAAGAGGTGGAAAAGTTGATAAGAAACATGCTAATGAAGCCAGACGTGTTTGTTTGTGGTGCATTACTTGGAGGCTGTCAATCACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

7.0

Weight (kDa)

8.96

Isoelectric Point (pI)

68.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 2 cut(s) 16, 135
AgsI TTSAA 2 cut(s) 32, 92
AjiI CACGTC 1 cut(s) 136
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AoxI GGCC 1 cut(s) 78
BciT130I CCWGG 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 82
BmgBI CACGTC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 82
BshFI GGCC 1 cut(s) 80
BsnI GGCC 1 cut(s) 80
BspANI GGCC 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 87
BstC8I GCNNGC 2 cut(s) 55, 78
BstDEI CTNAG 1 cut(s) 71
BstMWI GCNNNNNNNGC 2 cut(s) 82, 127
BstNI CCWGG 1 cut(s) 82
BstNSI RCATGY 2 cut(s) 57, 121
BstSCI CCNGG 1 cut(s) 80
BsuRI GGCC 1 cut(s) 80
BtrI CACGTC 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 55, 78
CviAII CATG 2 cut(s) 54, 118
CviJI RGCY 5 cut(s) 40, 80, 85, 130, 165
CviKI_1 RGCY 5 cut(s) 40, 80, 85, 130, 165
DdeI CTNAG 1 cut(s) 71
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 80
EcoT22I ATGCAT 1 cut(s) 59
FaeI CATG 2 cut(s) 57, 121
FaiI YATR 2 cut(s) 55, 119
FatI CATG 2 cut(s) 53, 117
HaeIII GGCC 1 cut(s) 80
Hin1II CATG 2 cut(s) 57, 121
Hpy166II GTNNAC 1 cut(s) 22
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4IV ACGT 2 cut(s) 16, 135
HpyCH4V TGCA 2 cut(s) 57, 152
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 127
HpyF3I CTNAG 1 cut(s) 71
HpySE526I ACGT 2 cut(s) 16, 135
Hsp92II CATG 2 cut(s) 57, 121
LpnPI CCDG 4 cut(s) 62, 67, 94, 144
MaeII ACGT 2 cut(s) 16, 135
MboII GAAGA 2 cut(s) 22, 104
MluCI AATT 1 cut(s) 87
MnlI CCTC 2 cut(s) 88, 155
Mph1103I ATGCAT 1 cut(s) 59
MslI CAYNNNNRTG 1 cut(s) 122
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
MwoI GCNNNNNNNGC 2 cut(s) 82, 127
NlaIII CATG 2 cut(s) 57, 121
NsiI ATGCAT 1 cut(s) 59
NspI RCATGY 2 cut(s) 57, 121
PaeI GCATGC 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
RseI CAYNNNNRTG 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 82
SetI ASST 4 cut(s) 19, 42, 99, 138
SgeI CNNG 9 cut(s) 29, 66, 89, 93, 94, 130, 143, 148, 170
SmiMI CAYNNNNRTG 1 cut(s) 122
SphI GCATGC 1 cut(s) 57
Sse9I AATT 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 80
TaiI ACGT 2 cut(s) 19, 138
TaqI TCGA 1 cut(s) 8
TasI AATT 1 cut(s) 87
TspDTI ATGAA 1 cut(s) 140
XceI RCATGY 2 cut(s) 57, 121
Zsp2I ATGCAT 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.