Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp06

Orthogroup ID

OG0003579

Physical Location & Seq

Genomic Coordinates Reverse (-)

22392187 .. 22395782

Gene Structure 3596 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.6G216800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 798 bp

ATGGCCCTAATCTCCCCGCAAATCCTAACCCTTAAATCCCCTTCAACCCCCTCTCTTCCTTCTCATTCATCTCTCATCGCCCCTTCCCAATCTCCCTCTTTCTCACCTCCTAACACTCCACGCTCTCCCTCCCTCTTCTGCTCCCCAAAATCAACAACACAGTATAGCTCCAGACGACTTGTAGTTTCCAGAGCCTCCACCAACGCATCTGCTTTGGATTTCAGCCCCAGCATCGGTGAGGTCCTCGGTGATGTTAGCATTTTCACCGCTGCTGGTGATTCCGTCCAGTTCAAAGACCTCTGGGATCTGAACGAGGGGGTGGCTGTTGTTGCACTATTGAGGCACTTTGGATGCCCTTGCTGTTGGGAACTTGCCTCGGCTCTAAAAGAATCTAAAGCTAGATTTGATTCAGCTGGTGTGAAAATAATTGCAGTTGGTGTTGGTAGTCCTGATAAAGCTCGTATCCTTGCAGAACGGTTACCATTTCCAATGGATAGCCTTTATGCTGATCCTGATCGCAAGGCATACAATGTGTTGGGCTTATACTATGGACTTGGTCGAACTTTCTTCAATCCAGCTAGTGCAAAGGTGTTTTCAAGATTTGAGGCTCTGCAGAAAGCTGTAAAAAACTATACCATTGAGGCCACTCCAGATGACAGAAGTAGTGTGTTACAACAGGGAGGGATGTTTGTCTTTAAAGGTAAGCAATTGTTGTATGCTCGGAAAGATGAAGGGACGGGTGATCATGCCCCATTAGATGATATCTTGGATGTTTGCTGCAAAGTTCCTGTCTCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AhpC-TSA_2

Protein Analysis

266

Amino Acids

28.54

Weight (kDa)

8.48

Isoelectric Point (pI)

56.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003579)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G65840
fragaria_vesca	FvH4_1g18230 FvH4_1g18230 FvH4_1g18250 FvH4_1g18251
malus_domestica	MD02G1189600.v1.1
prunus_persica	Prupe.6G216800_v2.0.a1
pyrus_communis	pycom02g15370
rosa_chinensis	RchiOBHm_Chr2g0108751 RchiOBHm_Chr2g0108761 RchiOBHm_Chr2g0108771
rosa_laevigata	RLG00000017689 RLG00000017690
rosa_multiflora	Rmu_co8430739.1_g000001 Rmu_sc0009410.1_g000001 Rmu_sc0010317.1_g000002
rosa_roxburghii	Rroxscaffold_2G00134820 Rroxscaffold_2G00134830 Rroxscaffold_2G00134840
rosa_rugosa	Rorug02G0155400 Rorug02G0155400 Rorug02G0155700 Rorug02G0155800
rosa_samantha	Rh2AG205700 Rh2AG205900 Rh2AG206000 Rh2BG217500 Rh2CG208600 Rh2CG208900 Rh2DG211900 Rh2DG212300 Rh2DG212400
rosa_wichuraiana	Rw2G016370 Rw2G016390 Rw2G016400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	17, 267
AclWI	GGATC	2 cut(s)	312, 503
AfiI	CCNNNNNNNGG	1 cut(s)	233
AgsI	TTSAA	4 cut(s)	45, 292, 571, 597
AluBI	AGCT	6 cut(s)	168, 398, 413, 458, 578, 620
AluI	AGCT	6 cut(s)	168, 398, 413, 458, 578, 620
AlwI	GGATC	2 cut(s)	312, 503
AoxI	GGCC	2 cut(s)	3, 642
ApeKI	GCWGC	2 cut(s)	269, 777
ArsI	GACNNNNNNTTYG	1 cut(s)	774
AspS9I	GGNCC	2 cut(s)	4, 241
AsuHPI	GGTGA	6 cut(s)	96, 248, 256, 260, 287, 752
AvaII	GGWCC	1 cut(s)	241
BbvI	GCAGC	2 cut(s)	256, 764
BciVI	GTATCC	1 cut(s)	473
BclI	TGATCA	1 cut(s)	742
BfaI	CTAG	2 cut(s)	399, 579
BfmI	CTRYAG	1 cut(s)	611
BfuI	GTATCC	1 cut(s)	473
BisI	GCNGC	2 cut(s)	270, 778
BlsI	GCNGC	2 cut(s)	271, 779
Bme18I	GGWCC	1 cut(s)	241
BmgT120I	GGNCC	2 cut(s)	4, 241
BmsI	GCATC	3 cut(s)	215, 240, 341
BpmI	CTGGAG	2 cut(s)	154, 633
BsaBI	GATNNNNATC	1 cut(s)	513
BsaJI	CCNNGG	2 cut(s)	244, 375
Bsc4I	CCNNNNNNNGG	1 cut(s)	233
Bse1I	ACTGG	1 cut(s)	286
Bse8I	GATNNNNATC	1 cut(s)	513
BseDI	CCNNGG	2 cut(s)	244, 375
BseGI	GGATG	3 cut(s)	356, 690, 775
BseJI	GATNNNNATC	1 cut(s)	513
BseLI	CCNNNNNNNGG	1 cut(s)	233
BseNI	ACTGG	1 cut(s)	286
BseXI	GCAGC	2 cut(s)	256, 764
BseYI	CCCAGC	1 cut(s)	227
BshFI	GGCC	2 cut(s)	5, 644
BslFI	GGGAC	1 cut(s)	748
BslI	CCNNNNNNNGG	1 cut(s)	233
BsmFI	GGGAC	1 cut(s)	748
BsnI	GGCC	2 cut(s)	5, 644
Bsp143I	GATC	4 cut(s)	304, 508, 514, 742
BspACI	CCGC	2 cut(s)	17, 267
BspANI	GGCC	2 cut(s)	5, 644
BspMAI	CTGCAG	1 cut(s)	615
BspPI	GGATC	2 cut(s)	312, 503
BsrI	ACTGG	1 cut(s)	286
BssECI	CCNNGG	2 cut(s)	244, 375
BssMI	GATC	4 cut(s)	304, 508, 514, 742
Bst4CI	ACNGT	2 cut(s)	162, 477
Bst6I	CTCTTC	2 cut(s)	60, 140
BstEII	GGTNACC	1 cut(s)	477
BstF5I	GGATG	3 cut(s)	356, 690, 775
BstKTI	GATC	4 cut(s)	307, 511, 517, 745
BstMBI	GATC	4 cut(s)	304, 508, 514, 742
BstMWI	GCNNNNNNNGC	1 cut(s)	329
BstPI	GGTNACC	1 cut(s)	477
BstSFI	CTRYAG	1 cut(s)	611
BstV1I	GCAGC	2 cut(s)	256, 764
BstX2I	RGATCY	1 cut(s)	304
BstYI	RGATCY	1 cut(s)	304
BsuI	GTATCC	1 cut(s)	473
BsuRI	GGCC	2 cut(s)	5, 644
BtgZI	GCGATG	1 cut(s)	61
BtsCI	GGATG	3 cut(s)	356, 690, 775
Cfr13I	GGNCC	2 cut(s)	4, 241
CviAII	CATG	1 cut(s)	746
DpnI	GATC	4 cut(s)	306, 510, 516, 744
DpnII	GATC	4 cut(s)	304, 508, 514, 742
DraI	TTTAAA	1 cut(s)	697
Eam1104I	CTCTTC	2 cut(s)	60, 140
EarI	CTCTTC	2 cut(s)	60, 140
Eco32I	GATATC	1 cut(s)	763
Eco47I	GGWCC	1 cut(s)	241
Eco91I	GGTNACC	1 cut(s)	477
EcoO109I	RGGNCCY	1 cut(s)	241
EcoO65I	GGTNACC	1 cut(s)	477
EcoRV	GATATC	1 cut(s)	763
FaeI	CATG	1 cut(s)	749
FaiI	YATR	8 cut(s)	165, 504, 526, 544, 549, 633, 717, 747
FaqI	GGGAC	1 cut(s)	748
FatI	CATG	1 cut(s)	745
FauI	CCCGC	1 cut(s)	24
FbaI	TGATCA	1 cut(s)	742
Fnu4HI	GCNGC	2 cut(s)	270, 778
FokI	GGATG	3 cut(s)	363, 697, 782
Fsp4HI	GCNGC	2 cut(s)	270, 778
FspBI	CTAG	2 cut(s)	399, 579
GluI	GCNGC	2 cut(s)	270, 778
GsaI	CCCAGC	1 cut(s)	231
GsuI	CTGGAG	2 cut(s)	154, 633
HaeIII	GGCC	2 cut(s)	5, 644
Hin1II	CATG	1 cut(s)	749
HinfI	GANTC	3 cut(s)	278, 389, 407
HphI	GGTGA	6 cut(s)	96, 248, 256, 260, 287, 752
Hpy188I	TCNGA	2 cut(s)	309, 723
Hpy188III	TCNNGA	6 cut(s)	171, 189, 449, 512, 597, 650
HpyAV	CCTTC	4 cut(s)	51, 69, 93, 725
HpyCH4III	ACNGT	2 cut(s)	162, 477
HpyCH4V	TGCA	6 cut(s)	332, 431, 470, 584, 613, 780
HpyF10VI	GCNNNNNNNGC	1 cut(s)	329
Hsp92II	CATG	1 cut(s)	749
Ksp22I	TGATCA	1 cut(s)	742
Kzo9I	GATC	4 cut(s)	304, 508, 514, 742
LmnI	GCTCC	2 cut(s)	146, 173
Lsp1109I	GCAGC	2 cut(s)	256, 764
LweI	GCATC	3 cut(s)	215, 240, 341
MaeI	CTAG	2 cut(s)	399, 579
MaeIII	GTNAC	2 cut(s)	477, 669
MalI	GATC	4 cut(s)	306, 510, 516, 744
MboI	GATC	4 cut(s)	304, 508, 514, 742
MboII	GAAGA	3 cut(s)	47, 127, 559
MfeI	CAATTG	1 cut(s)	707
MflI	RGATCY	1 cut(s)	304
MluCI	AATT	2 cut(s)	426, 707
MseI	TTAA	2 cut(s)	33, 696
MspA1I	CMGCKG	2 cut(s)	269, 413
MunI	CAATTG	1 cut(s)	707
MwoI	GCNNNNNNNGC	1 cut(s)	329
NdeII	GATC	4 cut(s)	304, 508, 514, 742
NlaIII	CATG	1 cut(s)	749
NmeAIII	GCCGAG	1 cut(s)	356
PfeI	GAWTC	3 cut(s)	278, 389, 407
PflFI	GACNNNGTC	1 cut(s)	555
PkrI	GCNGC	2 cut(s)	271, 779
PpuMI	RGGWCCY	1 cut(s)	241
Psp5II	RGGWCCY	1 cut(s)	241
PspEI	GGTNACC	1 cut(s)	477
PspFI	CCCAGC	1 cut(s)	227
PspPI	GGNCC	2 cut(s)	4, 241
PspPPI	RGGWCCY	1 cut(s)	241
PstI	CTGCAG	1 cut(s)	615
PsuI	RGATCY	1 cut(s)	304
PsyI	GACNNNGTC	1 cut(s)	555
PvuII	CAGCTG	1 cut(s)	413
SaqAI	TTAA	2 cut(s)	33, 696
SatI	GCNGC	2 cut(s)	270, 778
Sau3AI	GATC	4 cut(s)	304, 508, 514, 742
Sau96I	GGNCC	2 cut(s)	4, 241
SfaNI	GCATC	3 cut(s)	215, 240, 341
SfcI	CTRYAG	1 cut(s)	611
SinI	GGWCC	1 cut(s)	241
Sse9I	AATT	2 cut(s)	426, 707
SsiI	CCGC	2 cut(s)	17, 267
SspMI	CTAG	2 cut(s)	399, 579
TaaI	ACNGT	2 cut(s)	162, 477
TaqI	TCGA	1 cut(s)	559
TasI	AATT	2 cut(s)	426, 707
TfiI	GAWTC	3 cut(s)	278, 389, 407
Tru1I	TTAA	2 cut(s)	33, 696
Tru9I	TTAA	2 cut(s)	33, 696
TseI	GCWGC	2 cut(s)	269, 777
TspDTI	ATGAA	2 cut(s)	57, 744
TspGWI	ACGGA	1 cut(s)	271
Tth111I	GACNNNGTC	1 cut(s)	555
VpaK11BI	GGWCC	1 cut(s)	241
XspI	CTAG	2 cut(s)	399, 579

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.