Rh2CG208600

Thioredoxin-like protein AAED1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0003579
Physical Location & Seq
Forward (+)
20371328 .. 20373877
2550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG208600.1

Sequence Viewer

Length: 555 bp
ATGGCCCTAATCTCCACACAAACCCTAACCCTGAAATCCCCTCTTAACCTTTCTCTTCCTTCTCATCCATCTTCCCAATCTTTCTCACTCTCACCATCCACTCCTCACTCCTCACCACCAACAGCACGGTTTAGTGCTAGACGACTTGGCCTTTCCAGAGCCACCACATCCTCTGCTTTGGATTTCAGCCCCAGCATCGGTGAGGTCCTCGGTGAAGTTGGTATCTTCACCGCTGCTGGTGATCCCGTCCGGTTCAACGATCTATTGGATCAAAACGAGGCATATGATGTTTTGGGCTTATACTTTGGATTGGGTCGAACATTCTTCAATCCAGCTAGTGCAAAGGTGTTCTCAAGAATTGAGGCCCTGCAGAAAGCTTTAAAGAACTATACGATTAAAGCCACTCCAGATGATATAAATAGTGTGTTACAACAGGGTGGGATGTTCGTCTTCAAAGGGAAGCAGTTATTGTATGCTCGGAAAGACGAAGGGACAGGTGATCATGCCCCATTAGATGATATCTTTGATGTTTGTTGCAAAGTTCCTGTCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AhpC-TSA_2

Protein Analysis

184

Amino Acids

19.8

Weight (kDa)

6.82

Isoelectric Point (pI)

47.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AhpC-TSA_2 PF13911 89 - 163 6.5e-06 AhpC/TSA antioxidant enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 231
AclWI GGATC 2 cut(s) 236, 276
AfiI CCNNNNNNNGG 1 cut(s) 197
AgsI TTSAA 3 cut(s) 256, 328, 454
AluBI AGCT 2 cut(s) 335, 377
AluI AGCT 2 cut(s) 335, 377
AlwI GGATC 2 cut(s) 236, 276
AoxI GGCC 3 cut(s) 3, 148, 363
ApeKI GCWGC 1 cut(s) 233
ArsI GACNNNNNNTTYG 1 cut(s) 531
AspS9I GGNCC 3 cut(s) 4, 205, 364
AsuHPI GGTGA 7 cut(s) 84, 105, 212, 220, 224, 251, 509
AvaII GGWCC 1 cut(s) 205
BbsI GAAGAC 1 cut(s) 442
BbvI GCAGC 1 cut(s) 220
BccI CCATC 2 cut(s) 76, 103
BclI TGATCA 1 cut(s) 499
BfaI CTAG 2 cut(s) 138, 336
BfmI CTRYAG 1 cut(s) 368
BisI GCNGC 1 cut(s) 234
BlsI GCNGC 1 cut(s) 235
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 3 cut(s) 4, 205, 364
BmsI GCATC 1 cut(s) 204
BpiI GAAGAC 1 cut(s) 442
BpmI CTGGAG 1 cut(s) 390
BpuEI CTTGAG 1 cut(s) 337
BsaJI CCNNGG 1 cut(s) 208
BsaWI WCCGGW 1 cut(s) 249
Bsc4I CCNNNNNNNGG 1 cut(s) 197
BseDI CCNNGG 1 cut(s) 208
BseGI GGATG 4 cut(s) 64, 95, 167, 447
BseLI CCNNNNNNNGG 1 cut(s) 197
BseRI GAGGAG 2 cut(s) 93, 100
BseXI GCAGC 1 cut(s) 220
BseYI CCCAGC 1 cut(s) 191
BshFI GGCC 3 cut(s) 5, 150, 365
BsiSI CCGG 1 cut(s) 250
BslFI GGGAC 1 cut(s) 505
BslI CCNNNNNNNGG 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 505
BsnI GGCC 3 cut(s) 5, 150, 365
Bsp143I GATC 4 cut(s) 241, 259, 268, 499
BspACI CCGC 1 cut(s) 231
BspANI GGCC 3 cut(s) 5, 150, 365
BspMAI CTGCAG 1 cut(s) 372
BspPI GGATC 2 cut(s) 236, 276
BssECI CCNNGG 1 cut(s) 208
BssMI GATC 4 cut(s) 241, 259, 268, 499
Bst4CI ACNGT 1 cut(s) 129
Bst6I CTCTTC 1 cut(s) 60
BstF5I GGATG 4 cut(s) 64, 95, 167, 447
BstKTI GATC 4 cut(s) 244, 262, 271, 502
BstMBI GATC 4 cut(s) 241, 259, 268, 499
BstSFI CTRYAG 1 cut(s) 368
BstV1I GCAGC 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 442
BsuRI GGCC 3 cut(s) 5, 150, 365
BtsCI GGATG 4 cut(s) 64, 95, 167, 447
Cfr13I GGNCC 3 cut(s) 4, 205, 364
CviAII CATG 1 cut(s) 503
CviJI RGCY 9 cut(s) 5, 150, 161, 189, 297, 335, 365, 377, 401
CviKI_1 RGCY 9 cut(s) 5, 150, 161, 189, 297, 335, 365, 377, 401
DpnI GATC 4 cut(s) 243, 261, 270, 501
DpnII GATC 4 cut(s) 241, 259, 268, 499
DraI TTTAAA 1 cut(s) 381
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Eco32I GATATC 1 cut(s) 520
Eco47I GGWCC 1 cut(s) 205
EcoO109I RGGNCCY 2 cut(s) 205, 364
EcoRV GATATC 1 cut(s) 520
FaeI CATG 1 cut(s) 506
FaiI YATR 7 cut(s) 283, 285, 301, 390, 416, 474, 504
FaqI GGGAC 1 cut(s) 505
FatI CATG 1 cut(s) 502
FauNDI CATATG 1 cut(s) 283
FbaI TGATCA 1 cut(s) 499
Fnu4HI GCNGC 1 cut(s) 234
FokI GGATG 4 cut(s) 51, 82, 154, 454
Fsp4HI GCNGC 1 cut(s) 234
FspBI CTAG 2 cut(s) 138, 336
GluI GCNGC 1 cut(s) 234
GsaI CCCAGC 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 390
HaeIII GGCC 3 cut(s) 5, 150, 365
HapII CCGG 1 cut(s) 250
Hin1II CATG 1 cut(s) 506
HindIII AAGCTT 1 cut(s) 375
HpaII CCGG 1 cut(s) 250
HphI GGTGA 7 cut(s) 84, 105, 212, 220, 224, 251, 509
Hpy188I TCNGA 1 cut(s) 480
Hpy188III TCNNGA 4 cut(s) 156, 354, 407, 552
HpyAV CCTTC 2 cut(s) 69, 482
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4V TGCA 3 cut(s) 341, 370, 537
Hsp92II CATG 1 cut(s) 506
Ksp22I TGATCA 1 cut(s) 499
Kzo9I GATC 4 cut(s) 241, 259, 268, 499
Lsp1109I GCAGC 1 cut(s) 220
LweI GCATC 1 cut(s) 204
MaeI CTAG 2 cut(s) 138, 336
MaeIII GTNAC 1 cut(s) 426
MalI GATC 4 cut(s) 243, 261, 270, 501
MboI GATC 4 cut(s) 241, 259, 268, 499
MboII GAAGA 5 cut(s) 47, 63, 217, 316, 442
MluCI AATT 1 cut(s) 357
MnlI CCTC 8 cut(s) 51, 114, 121, 181, 196, 218, 271, 355
MseI TTAA 3 cut(s) 45, 380, 396
MspA1I CMGCKG 1 cut(s) 233
MspI CCGG 1 cut(s) 250
NdeI CATATG 1 cut(s) 283
NdeII GATC 4 cut(s) 241, 259, 268, 499
NlaIII CATG 1 cut(s) 506
PkrI GCNGC 1 cut(s) 235
PpuMI RGGWCCY 1 cut(s) 205
Psp5II RGGWCCY 1 cut(s) 205
PspFI CCCAGC 1 cut(s) 191
PspPI GGNCC 3 cut(s) 4, 205, 364
PspPPI RGGWCCY 1 cut(s) 205
PstI CTGCAG 1 cut(s) 372
SaqAI TTAA 3 cut(s) 45, 380, 396
SatI GCNGC 1 cut(s) 234
Sau3AI GATC 4 cut(s) 241, 259, 268, 499
Sau96I GGNCC 3 cut(s) 4, 205, 364
SetI ASST 6 cut(s) 51, 207, 337, 348, 379, 499
SfaNI GCATC 1 cut(s) 204
SfcI CTRYAG 1 cut(s) 368
SinI GGWCC 1 cut(s) 205
SmlI CTYRAG 1 cut(s) 352
SmoI CTYRAG 1 cut(s) 352
Sse9I AATT 1 cut(s) 357
SsiI CCGC 1 cut(s) 231
SspMI CTAG 2 cut(s) 138, 336
TaaI ACNGT 1 cut(s) 129
TaqI TCGA 1 cut(s) 316
TasI AATT 1 cut(s) 357
Tru1I TTAA 3 cut(s) 45, 380, 396
Tru9I TTAA 3 cut(s) 45, 380, 396
TseI GCWGC 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 205
XspI CTAG 2 cut(s) 138, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.