pycom02g23320

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0001201
Physical Location & Seq
Forward (+)
21411625 .. 21411861
237 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g23320.1

Sequence Viewer

Length: 237 bp
ATGTTCAAGACCATGATCGAGCGCCTCATATCAACCCTACAGATTTCCAAAAATTACATTACACCTGGTTTGAAAGACAAATGGGGCTTATACGAGAAGCAGATACTAAACGTCATTGATGCAAAAAGACCTAGGAAGCAGATCCCCTCGTCTGATTTGCACTCCACCCAGCAGCCATACTCTCAACGCCTCGCTGCAGAAGTAAAACTAGAGCAAATAGAAGGCGAGGGTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

79

Amino Acids

9.06

Weight (kDa)

9.3

Isoelectric Point (pI)

43.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 136
AgsI TTSAA 2 cut(s) 7, 73
AjnI CCWGG 1 cut(s) 64
AlwI GGATC 1 cut(s) 136
ApeKI GCWGC 2 cut(s) 172, 194
AspA2I CCTAGG 1 cut(s) 131
AspLEI GCGC 1 cut(s) 24
AvrII CCTAGG 1 cut(s) 131
BbvI GCAGC 2 cut(s) 181, 184
BciT130I CCWGG 1 cut(s) 66
BfaI CTAG 2 cut(s) 132, 209
BfmI CTRYAG 2 cut(s) 38, 195
BfoI RGCGCY 1 cut(s) 25
BisI GCNGC 2 cut(s) 173, 195
BlnI CCTAGG 1 cut(s) 131
BlsI GCNGC 2 cut(s) 174, 196
Bme1390I CCNGG 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 66
BmsI GCATC 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 131
BseBI CCWGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 131
BseXI GCAGC 2 cut(s) 181, 184
BseYI CCCAGC 1 cut(s) 168
Bsp143I GATC 2 cut(s) 15, 141
BspMAI CTGCAG 1 cut(s) 199
BspPI GGATC 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 2 cut(s) 15, 141
BssT1I CCWWGG 1 cut(s) 131
Bst2UI CCWGG 1 cut(s) 66
BstH2I RGCGCY 1 cut(s) 25
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 2 cut(s) 18, 144
BstMBI GATC 2 cut(s) 15, 141
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BstSFI CTRYAG 2 cut(s) 38, 195
BstV1I GCAGC 2 cut(s) 181, 184
BstX2I RGATCY 1 cut(s) 141
BstYI RGATCY 1 cut(s) 141
CfoI GCGC 1 cut(s) 24
CsiI ACCWGGT 1 cut(s) 64
CviAII CATG 1 cut(s) 13
CviJI RGCY 2 cut(s) 87, 175
CviKI_1 RGCY 2 cut(s) 87, 175
DpnI GATC 2 cut(s) 17, 143
DpnII GATC 2 cut(s) 15, 141
Eco130I CCWWGG 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 131
FaeI CATG 1 cut(s) 16
FaiI YATR 4 cut(s) 14, 29, 91, 178
FatI CATG 1 cut(s) 12
Fnu4HI GCNGC 2 cut(s) 173, 195
Fsp4HI GCNGC 2 cut(s) 173, 195
FspBI CTAG 2 cut(s) 132, 209
GlaI GCGC 1 cut(s) 23
GluI GCNGC 2 cut(s) 173, 195
GsaI CCCAGC 1 cut(s) 172
HaeII RGCGCY 1 cut(s) 25
HhaI GCGC 1 cut(s) 24
Hin1II CATG 1 cut(s) 16
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 215
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 3 cut(s) 122, 160, 197
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 16
HspAI GCGC 1 cut(s) 22
Kzo9I GATC 2 cut(s) 15, 141
LpnPI CCDG 3 cut(s) 51, 78, 182
Lsp1109I GCAGC 2 cut(s) 181, 184
LweI GCATC 1 cut(s) 109
MabI ACCWGGT 1 cut(s) 64
MaeI CTAG 2 cut(s) 132, 209
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 230
MalI GATC 2 cut(s) 17, 143
MboI GATC 2 cut(s) 15, 141
MflI RGATCY 1 cut(s) 141
MluCI AATT 1 cut(s) 52
MnlI CCTC 4 cut(s) 35, 157, 200, 220
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
NdeII GATC 2 cut(s) 15, 141
NlaIII CATG 1 cut(s) 16
PkrI GCNGC 2 cut(s) 174, 196
Psp6I CCWGG 1 cut(s) 64
PspFI CCCAGC 1 cut(s) 168
PspGI CCWGG 1 cut(s) 64
PstI CTGCAG 1 cut(s) 199
PsuI RGATCY 1 cut(s) 141
SatI GCNGC 2 cut(s) 173, 195
Sau3AI GATC 2 cut(s) 15, 141
ScrFI CCNGG 1 cut(s) 66
SetI ASST 3 cut(s) 67, 114, 133
SexAI ACCWGGT 1 cut(s) 64
SfaNI GCATC 1 cut(s) 109
SfcI CTRYAG 2 cut(s) 38, 195
Sse9I AATT 1 cut(s) 52
SspMI CTAG 2 cut(s) 132, 209
StyD4I CCNGG 1 cut(s) 64
StyI CCWWGG 1 cut(s) 131
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 18
TasI AATT 1 cut(s) 52
TseI GCWGC 2 cut(s) 172, 194
XmaJI CCTAGG 1 cut(s) 131
XspI CTAG 2 cut(s) 132, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.