Rmu_co8383039.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8383039.1
OG0001201
Physical Location & Seq
Reverse (-)
2 .. 695
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8383039.1_g000001.1.cds

Sequence Viewer

Length: 550 bp
atgaaggagatgtactactccgaactaagtgaaatgtacccaaaacttgctactaaaattcatcagtacgagtcccttccacaacagccaatgtcagatcggcttgagaagctgaagatgtttaagaccttgctggagcacctgattgctgtcttacaaatttccaaaactaacatatcacctggtttgaaggagaagttggatttatatgagaagcagatgataaattttattaatgtaaatagacccaggactactcaagtgcaatctcatgaaaatcagatgatcctacaattgcaatccctgaacttgcaaggttccgtgccaacaatgcagcagaacaatatgacgggcttgcagcaaaattctatgtcttctttatctggggtttcaacagcacagcaaaacatgatgaatcgattgcagccaagttccaatatttatccaggacaaggaaccgcactgaactcactgcagcaggttcctgtgggctctgtccaacaagcttctgtcagtgctccccaacaagttaacatgaatgccttaccat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

183

Amino Acids

20.62

Weight (kDa)

9.16

Isoelectric Point (pI)

61.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 469
AciI CCGC 1 cut(s) 459
AclWI GGATC 1 cut(s) 280
AcsI RAATTY 4 cut(s) 57, 159, 226, 364
AcuI CTGAAG 1 cut(s) 134
AfaI GTAC 3 cut(s) 14, 38, 68
AfiI CCNNNNNNNGG 1 cut(s) 452
AgsI TTSAA 2 cut(s) 190, 393
AjnI CCWGG 3 cut(s) 181, 248, 445
AjuI GAANNNNNNNTTGG 2 cut(s) 182, 214
AluBI AGCT 2 cut(s) 112, 506
AluI AGCT 2 cut(s) 112, 506
Alw21I GWGCWC 2 cut(s) 141, 520
AlwI GGATC 1 cut(s) 280
ApeKI GCWGC 4 cut(s) 334, 358, 424, 475
ApoI RAATTY 4 cut(s) 57, 159, 226, 364
AseI ATTAAT 1 cut(s) 234
AsuHPI GGTGA 1 cut(s) 171
BanII GRGCYC 1 cut(s) 494
BarI GAAGNNNNNNTAC 1 cut(s) 28
BbsI GAAGAC 1 cut(s) 366
Bbv12I GWGCWC 2 cut(s) 141, 520
BbvI GCAGC 4 cut(s) 346, 370, 436, 487
BciT130I CCWGG 3 cut(s) 183, 250, 447
BfmI CTRYAG 1 cut(s) 473
BfuAI ACCTGC 1 cut(s) 469
BisI GCNGC 4 cut(s) 335, 359, 425, 476
BlsI GCNGC 4 cut(s) 336, 360, 426, 477
Bme1390I CCNGG 3 cut(s) 183, 250, 447
BmiI GGNNCC 3 cut(s) 319, 457, 483
BmrFI CCNGG 3 cut(s) 183, 250, 447
BpiI GAAGAC 1 cut(s) 366
BpmI CTGGAG 1 cut(s) 155
BpuEI CTTGAG 2 cut(s) 125, 243
Bsa29I ATCGAT 1 cut(s) 418
BsaJI CCNNGG 1 cut(s) 248
Bsc4I CCNNNNNNNGG 1 cut(s) 452
BseBI CCWGG 3 cut(s) 183, 250, 447
BseCI ATCGAT 1 cut(s) 418
BseDI CCNNGG 1 cut(s) 248
BseLI CCNNNNNNNGG 1 cut(s) 452
BseXI GCAGC 4 cut(s) 346, 370, 436, 487
BshVI ATCGAT 1 cut(s) 418
BsiHKAI GWGCWC 2 cut(s) 141, 520
BslFI GGGAC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 452
BsmFI GGGAC 1 cut(s) 58
BsmI GAATGC 1 cut(s) 544
Bsp1286I GDGCHC 3 cut(s) 141, 494, 520
Bsp143I GATC 2 cut(s) 97, 285
BspACI CCGC 1 cut(s) 459
BspDI ATCGAT 1 cut(s) 418
BspHI TCATGA 1 cut(s) 271
BspLI GGNNCC 3 cut(s) 319, 457, 483
BspMAI CTGCAG 1 cut(s) 477
BspMI ACCTGC 1 cut(s) 469
BspPI GGATC 1 cut(s) 280
BssECI CCNNGG 1 cut(s) 248
BssMI GATC 2 cut(s) 97, 285
Bst2UI CCWGG 3 cut(s) 183, 250, 447
BstC8I GCNNGC 1 cut(s) 356
BstDEI CTNAG 1 cut(s) 26
BstKTI GATC 2 cut(s) 100, 288
BstMBI GATC 2 cut(s) 97, 285
BstMWI GCNNNNNNNGC 2 cut(s) 109, 331
BstNI CCWGG 3 cut(s) 183, 250, 447
BstSCI CCNGG 3 cut(s) 181, 248, 445
BstSFI CTRYAG 1 cut(s) 473
BstV1I GCAGC 4 cut(s) 346, 370, 436, 487
BstV2I GAAGAC 1 cut(s) 366
Bsu15I ATCGAT 1 cut(s) 418
BsuTUI ATCGAT 1 cut(s) 418
BtsI GCAGTG 1 cut(s) 470
BtsIMutI CAGTG 3 cut(s) 461, 470, 520
BveI ACCTGC 1 cut(s) 469
Cac8I GCNNGC 1 cut(s) 356
CciI TCATGA 1 cut(s) 271
ClaI ATCGAT 1 cut(s) 418
CsiI ACCWGGT 1 cut(s) 181
Csp6I GTAC 3 cut(s) 13, 37, 67
CviAII CATG 3 cut(s) 272, 409, 535
CviJI RGCY 7 cut(s) 88, 103, 112, 354, 427, 492, 506
CviKI_1 RGCY 7 cut(s) 88, 103, 112, 354, 427, 492, 506
CviQI GTAC 3 cut(s) 13, 37, 67
DdeI CTNAG 1 cut(s) 26
DpnI GATC 2 cut(s) 99, 287
DpnII GATC 2 cut(s) 97, 285
Eco24I GRGCYC 1 cut(s) 494
Eco57I CTGAAG 1 cut(s) 134
EcoRII CCWGG 3 cut(s) 181, 248, 445
EcoT38I GRGCYC 1 cut(s) 494
FaeI CATG 3 cut(s) 275, 412, 538
FaiI YATR 8 cut(s) 176, 208, 210, 273, 347, 371, 410, 536
FaqI GGGAC 1 cut(s) 58
FatI CATG 3 cut(s) 271, 408, 534
Fnu4HI GCNGC 4 cut(s) 335, 359, 425, 476
FriOI GRGCYC 1 cut(s) 494
Fsp4HI GCNGC 4 cut(s) 335, 359, 425, 476
GluI GCNGC 4 cut(s) 335, 359, 425, 476
GsuI CTGGAG 1 cut(s) 155
Hin1II CATG 3 cut(s) 275, 412, 538
HincII GTYRAC 1 cut(s) 532
HindII GTYRAC 1 cut(s) 532
HindIII AAGCTT 1 cut(s) 504
HinfI GANTC 2 cut(s) 71, 415
HpaI GTTAAC 1 cut(s) 532
HphI GGTGA 1 cut(s) 171
Hpy166II GTNNAC 1 cut(s) 532
Hpy188I TCNGA 3 cut(s) 22, 97, 282
Hpy188III TCNNGA 1 cut(s) 272
Hpy8I GTNNAC 1 cut(s) 532
HpyAV CCTTC 2 cut(s) 86, 184
HpyCH4V TGCA 7 cut(s) 265, 298, 313, 334, 358, 424, 475
HpyF10VI GCNNNNNNNGC 2 cut(s) 109, 331
HpyF3I CTNAG 1 cut(s) 26
Hsp92II CATG 3 cut(s) 275, 412, 538
KspAI GTTAAC 1 cut(s) 532
Kzo9I GATC 2 cut(s) 97, 285
LmnI GCTCC 2 cut(s) 136, 523
Lsp1109I GCAGC 4 cut(s) 346, 370, 436, 487
MabI ACCWGGT 1 cut(s) 181
MalI GATC 2 cut(s) 99, 287
MboI GATC 2 cut(s) 97, 285
MboII GAAGA 2 cut(s) 127, 366
MfeI CAATTG 1 cut(s) 293
MhlI GDGCHC 3 cut(s) 141, 494, 520
MluCI AATT 5 cut(s) 57, 159, 226, 293, 364
MlyI GAGTC 1 cut(s) 80
MmeI TCCRAC 2 cut(s) 180, 523
MseI TTAA 3 cut(s) 123, 234, 531
MspR9I CCNGG 3 cut(s) 183, 250, 447
MunI CAATTG 1 cut(s) 293
Mva1269I GAATGC 1 cut(s) 544
MvaI CCWGG 3 cut(s) 183, 250, 447
MwoI GCNNNNNNNGC 2 cut(s) 109, 331
NdeII GATC 2 cut(s) 97, 285
NlaIII CATG 3 cut(s) 275, 412, 538
NlaIV GGNNCC 3 cut(s) 319, 457, 483
PagI TCATGA 1 cut(s) 271
PctI GAATGC 1 cut(s) 544
PfeI GAWTC 1 cut(s) 415
PfoI TCCNGGA 1 cut(s) 445
PkrI GCNGC 4 cut(s) 336, 360, 426, 477
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PshBI ATTAAT 1 cut(s) 234
Psp6I CCWGG 3 cut(s) 181, 248, 445
PspGI CCWGG 3 cut(s) 181, 248, 445
PspN4I GGNNCC 3 cut(s) 319, 457, 483
PstI CTGCAG 1 cut(s) 477
RsaI GTAC 3 cut(s) 14, 38, 68
RsaNI GTAC 3 cut(s) 13, 37, 67
SaqAI TTAA 3 cut(s) 123, 234, 531
SatI GCNGC 4 cut(s) 335, 359, 425, 476
Sau3AI GATC 2 cut(s) 97, 285
SchI GAGTC 1 cut(s) 80
ScrFI CCNGG 3 cut(s) 183, 250, 447
SduI GDGCHC 3 cut(s) 141, 494, 520
SetI ASST 7 cut(s) 114, 131, 144, 184, 319, 483, 508
SexAI ACCWGGT 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 473
SmlI CTYRAG 2 cut(s) 104, 258
SmoI CTYRAG 2 cut(s) 104, 258
Sse9I AATT 5 cut(s) 57, 159, 226, 293, 364
SsiI CCGC 1 cut(s) 459
SspI AATATT 1 cut(s) 439
StyD4I CCNGG 3 cut(s) 181, 248, 445
TaqI TCGA 1 cut(s) 418
TasI AATT 5 cut(s) 57, 159, 226, 293, 364
TatI WGTACW 1 cut(s) 12
TfiI GAWTC 1 cut(s) 415
Tru1I TTAA 3 cut(s) 123, 234, 531
Tru9I TTAA 3 cut(s) 123, 234, 531
TscAI CASTG 3 cut(s) 468, 477, 520
TseI GCWGC 4 cut(s) 334, 358, 424, 475
TspDTI ATGAA 4 cut(s) 17, 50, 288, 428
TspGWI ACGGA 1 cut(s) 310
TspRI CASTG 3 cut(s) 468, 477, 520
VspI ATTAAT 1 cut(s) 234
XapI RAATTY 4 cut(s) 57, 159, 226, 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.