Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0001201

Physical Location & Seq

Genomic Coordinates Forward (+)

5235688 .. 5237351

Gene Structure 1664 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00082370.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGAGAATTGTCAATAAGATAGTGCATACATTGAAGATGCATCTTCCTTTCTCCAGTCAAGAGGGATTGCATGAACTCAAGAATATTGCTGTTAGGTTTGAGGAGAATATTTATAGTGCTACTACTAGCCAAGTACTTTTGGTTTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

KIX_2

Protein Analysis

49

Amino Acids

5.62

Weight (kDa)

8.25

Isoelectric Point (pI)

67.86

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
KIX_2	PF16987	2 - 44	7.9e-14	KIX domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001201)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G15772 AT1G15772 AT1G15772 AT1G15772
fragaria_vesca	FvH4_3g37510 FvH4_3g37510 FvH4_3g37510 FvH4_3g37510
malus_domestica	MD02G1272400.v1.1 MD03G1032800.v1.1 MD03G1033000.v1.1 MD03G1033200.v1.1 MD03G1033300.v1.1 MD03G1033600.v1.1 MD03G1033800.v1.1 MD03G1034600.v1.1
prunus_persica	Prupe.6G027600_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.6G027900_v2.0.a1 Prupe.I003700_v2.0.a1
pyrus_communis	pycom02g23320 pycom03g02630 pycom03g02650 pycom03g02660
rosa_chinensis	RchiOBHm_Chr5g0075821
rosa_laevigata	RLG00000036593 RLG00000036596
rosa_multiflora	Rmu_co8383039.1_g000001
rosa_roxburghii	Rroxscaffold_2G00082370
rosa_rugosa	Rorug05G0442800
rosa_samantha	Rh5BG520700 Rh5BG521000 Rh5CG544700 Rh5CG545100 Rh5DG533300
rosa_wichuraiana	Rw5G046390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	135
AgsI	TTSAA	1 cut(s)	34
BfaI	CTAG	1 cut(s)	126
BmcAI	AGTACT	1 cut(s)	135
BmsI	GCATC	2 cut(s)	27, 49
BpmI	CTGGAG	1 cut(s)	37
BpuEI	CTTGAG	1 cut(s)	62
Bse1I	ACTGG	1 cut(s)	54
BseNI	ACTGG	1 cut(s)	54
BseRI	GAGGAG	1 cut(s)	116
BsrI	ACTGG	1 cut(s)	54
Csp6I	GTAC	1 cut(s)	134
CviAII	CATG	1 cut(s)	71
CviJI	RGCY	1 cut(s)	129
CviKI_1	RGCY	1 cut(s)	129
CviQI	GTAC	1 cut(s)	134
EcoT22I	ATGCAT	1 cut(s)	42
FaeI	CATG	1 cut(s)	74
FaiI	YATR	3 cut(s)	27, 72, 114
FatI	CATG	1 cut(s)	70
FspBI	CTAG	1 cut(s)	126
FspEI	CC	8 cut(s)	47, 48, 60, 67, 79, 86, 125, 143
GsuI	CTGGAG	1 cut(s)	37
Hin1II	CATG	1 cut(s)	74
Hpy188III	TCNNGA	3 cut(s)	59, 79, 147
HpyCH4V	TGCA	3 cut(s)	25, 40, 70
Hsp92II	CATG	1 cut(s)	74
LpnPI	CCDG	1 cut(s)	67
LweI	GCATC	2 cut(s)	27, 49
MaeI	CTAG	1 cut(s)	126
MboII	GAAGA	2 cut(s)	35, 46
MluCI	AATT	1 cut(s)	6
MnlI	CCTC	2 cut(s)	55, 94
Mph1103I	ATGCAT	1 cut(s)	42
NlaIII	CATG	1 cut(s)	74
NsiI	ATGCAT	1 cut(s)	42
RsaI	GTAC	1 cut(s)	135
RsaNI	GTAC	1 cut(s)	134
ScaI	AGTACT	1 cut(s)	135
SetI	ASST	1 cut(s)	98
SfaNI	GCATC	2 cut(s)	27, 49
SgeI	CNNG	6 cut(s)	66, 71, 83, 91, 138, 143
SmlI	CTYRAG	1 cut(s)	77
SmoI	CTYRAG	1 cut(s)	77
Sse9I	AATT	1 cut(s)	6
SspI	AATATT	2 cut(s)	85, 109
SspMI	CTAG	1 cut(s)	126
TasI	AATT	1 cut(s)	6
TatI	WGTACW	1 cut(s)	133
TspDTI	ATGAA	1 cut(s)	87
XspI	CTAG	1 cut(s)	126
ZrmI	AGTACT	1 cut(s)	135
Zsp2I	ATGCAT	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.