Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr3

Orthogroup ID

OG0002798

Physical Location & Seq

Genomic Coordinates Forward (+)

21352459 .. 21353901

Gene Structure 1443 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom03g21000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 780 bp

ATGAGCCAGGGACAGCCACAAAGACGCCGACCGGACCAGTCCGAGGTTCAGGAACCCATAAAATACGGAGACGTCTTCAATGTCTCCGGCGAATTGGCTGACAGGCCCGTCGCGCCCCGCGACGCCGCCACTGCCCAAGCTGCTGAAAACCTAGTCCTTGGAGAGAATCCGAGGGGTGGCCCAGCTGCTGTCATGCAGTCGGCAGCTACGTACAACGAGCGCTTTGGCCTTGTTGGCCACCTTGACTCCACTAAAGTTGCCCGAGAGGAAGGCGTCACCGTTACTGAAACAATTAATCCCGATGGCAACCGCGTTGTCACTGAAAAAGTTGCTGGACAGGTTGTGGCCCAATATGTGGAGCCACCGGTGCCAATGGCATCTCCAGGAGGAGCGCTTGATCGAGATGTAATTACGATTGGTGAAGCGCTGGAGGCCAGTGCTTTGACGGCAGGAGACAAACCAATTGAACAAAGCGACGCCGCTGCAATACAAGCGGCTGAAATGAGAGCCACTGGACGCAATGAGATAGCACCCGGAGGTGTGGCGGCTGTAGCTCAGTATGCAGCCTCTGTTAACCCGCGCGACGTCAATAAAACGAAACTTGGTGACGTGTTAGAGGATGCAACTGAGAAGTTGCCTGCGGACAAACCTGTGACTAGAGAGGATGCAAAGGCGGTGATAGGAGCAGAGATACGTAACAGTCCAAATATGGCCACCACTCCAGGCGGAGTTGCTGAATCGCTGGCGGCAGCGGCTGGGCTTAACCAGAATGGGGGATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SMP

Protein Analysis

260

Amino Acids

26.71

Weight (kDa)

4.66

Isoelectric Point (pI)

42.2

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
SMP	PF04927	20 - 74	1.5e-18	Seed maturation protein
SMP	PF04927	137 - 194	8e-22	Seed maturation protein
SMP	PF04927	199 - 256	4.8e-22	Seed maturation protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002798)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22490
fragaria_vesca	FvH4_2g23290 FvH4_2g23300 FvH4_4g15690
malus_domestica	MD03G1262300.v1.1 MD03G1262400.v1.1 MD11G1283000.v1.1 MD13G1194000.v1.1
prunus_persica	Prupe.1G014800_v2.0.a1 Prupe.8G238700_v2.0.a1
pyrus_communis	pycom03g21000 pycom13g16630
rosa_chinensis	RchiOBHm_Chr4g0416111 RchiOBHm_Chr6g0290671 RchiOBHm_Chr6g0290701
rosa_laevigata	RLG00000008018 RLG00000012186
rosa_multiflora	Rmu_sc0000043.1_g000012 Rmu_sc0000750.1_g000001 Rmu_sc0006791.1_g000002
rosa_roxburghii	Rroxscaffold_5G00359910 Rroxscaffold_7G00176790 Rroxscaffold_7G00176810
rosa_rugosa	Rorug04G0138300 Rorug06G0214100 Rorug06G0214200
rosa_samantha	Rh4AG200800 Rh4BG198000 Rh4CG211900 Rh4DG198100 Rh6AG324600 Rh6AG324700 Rh6BG332300 Rh6CG338000 Rh6DG325300 Rh6DG325500
rosa_wichuraiana	Rw0G019010 Rw6G028180 Rw6G028190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	107
AatII	GACGTC	2 cut(s)	75, 588
AccB1I	GGYRCC	1 cut(s)	367
AccB7I	CCANNNNNTGG	1 cut(s)	355
AccII	CGCG	5 cut(s)	113, 120, 312, 580, 582
AcoI	YGGCCR	2 cut(s)	235, 711
AcyI	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
AfaI	GTAC	1 cut(s)	212
AfeI	AGCGCT	3 cut(s)	221, 393, 426
AfiI	CCNNNNNNNGG	4 cut(s)	43, 176, 355, 772
AflIII	ACRYGT	1 cut(s)	609
AgeI	ACCGGT	1 cut(s)	364
AgsI	TTSAA	2 cut(s)	79, 467
AjiI	CACGTC	1 cut(s)	610
AjnI	CCWGG	3 cut(s)	6, 382, 721
AluBI	AGCT	4 cut(s)	140, 185, 206, 554
AluI	AGCT	4 cut(s)	140, 185, 206, 554
Alw26I	GTCTC	3 cut(s)	63, 88, 447
AlwNI	CAGNNNCTG	3 cut(s)	188, 569, 755
Ama87I	CYCGRG	1 cut(s)	261
Aor51HI	AGCGCT	3 cut(s)	221, 393, 426
AoxI	GGCC	7 cut(s)	104, 178, 226, 235, 345, 432, 711
ApeKI	GCWGC	6 cut(s)	140, 185, 203, 482, 563, 749
AseI	ATTAAT	1 cut(s)	294
AsiGI	ACCGGT	1 cut(s)	364
AspLEI	GCGC	5 cut(s)	115, 222, 394, 427, 582
AspS9I	GGNCC	4 cut(s)	34, 105, 179, 346
AsuC2I	CCSGG	1 cut(s)	534
AsuHPI	GGTGA	4 cut(s)	268, 431, 617, 688
AvaI	CYCGRG	1 cut(s)	261
AvaII	GGWCC	1 cut(s)	34
BalI	TGGCCA	2 cut(s)	237, 713
BanI	GGYRCC	1 cut(s)	367
BbsI	GAAGAC	1 cut(s)	67
BbvI	GCAGC	6 cut(s)	127, 172, 215, 469, 575, 761
BccI	CCATC	1 cut(s)	296
BceAI	ACGGC	1 cut(s)	462
BcgI	CGANNNNNNTGC	2 cut(s)	464, 498
BciT130I	CCWGG	3 cut(s)	8, 384, 723
BcnI	CCSGG	1 cut(s)	534
BcoDI	GTCTC	3 cut(s)	63, 88, 447
BfaI	CTAG	2 cut(s)	152, 657
BfmI	CTRYAG	1 cut(s)	549
BfoI	RGCGCY	3 cut(s)	223, 395, 428
BglI	GCCNNNNNGGC	1 cut(s)	234
Bme1390I	CCNGG	4 cut(s)	8, 384, 534, 723
Bme18I	GGWCC	1 cut(s)	34
BmeT110I	CYCGRG	1 cut(s)	261
BmgBI	CACGTC	1 cut(s)	610
BmgT120I	GGNCC	4 cut(s)	34, 105, 179, 346
BmiI	GGNNCC	3 cut(s)	54, 360, 369
BmrFI	CCNGG	4 cut(s)	8, 384, 534, 723
BmsI	GCATC	3 cut(s)	386, 610, 655
BpiI	GAAGAC	1 cut(s)	67
BpmI	CTGGAG	3 cut(s)	366, 449, 705
BpuMI	CCSGG	1 cut(s)	534
BsaAI	YACGTR	2 cut(s)	210, 695
BsaHI	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
BsaJI	CCNNGG	4 cut(s)	7, 42, 157, 170
BsaWI	WCCGGW	2 cut(s)	31, 364
BsaXI	ACNNNNNCTCC	2 cut(s)	230, 260
Bsc4I	CCNNNNNNNGG	4 cut(s)	43, 176, 355, 772
Bse118I	RCCGGY	1 cut(s)	364
Bse1I	ACTGG	3 cut(s)	37, 435, 517
Bse3DI	GCAATG	1 cut(s)	526
BseBI	CCWGG	3 cut(s)	8, 384, 723
BseDI	CCNNGG	4 cut(s)	7, 42, 157, 170
BseGI	GGATG	2 cut(s)	625, 670
BseLI	CCNNNNNNNGG	4 cut(s)	43, 176, 355, 772
BseMI	GCAATG	1 cut(s)	526
BseMII	CTCAG	2 cut(s)	569, 618
BseNI	ACTGG	3 cut(s)	37, 435, 517
BseRI	GAGGAG	1 cut(s)	402
BseXI	GCAGC	6 cut(s)	127, 172, 215, 469, 575, 761
BseYI	CCCAGC	2 cut(s)	181, 755
Bsh1236I	CGCG	5 cut(s)	113, 120, 312, 580, 582
Bsh1285I	CGRYCG	1 cut(s)	32
BshFI	GGCC	7 cut(s)	106, 180, 228, 237, 347, 434, 713
BshNI	GGYRCC	1 cut(s)	367
BshTI	ACCGGT	1 cut(s)	364
BsiEI	CGRYCG	1 cut(s)	32
BsiHKCI	CYCGRG	1 cut(s)	261
BsiSI	CCGG	4 cut(s)	32, 87, 365, 534
BslFI	GGGAC	1 cut(s)	24
BslI	CCNNNNNNNGG	4 cut(s)	43, 176, 355, 772
BsmAI	GTCTC	3 cut(s)	63, 88, 447
BsmBI	CGTCTC	1 cut(s)	63
BsmFI	GGGAC	1 cut(s)	24
BsnI	GGCC	7 cut(s)	106, 180, 228, 237, 347, 434, 713
BsoBI	CYCGRG	1 cut(s)	261
Bsp143I	GATC	1 cut(s)	397
BspANI	GGCC	7 cut(s)	106, 180, 228, 237, 347, 434, 713
BspCNI	CTCAG	2 cut(s)	568, 619
BspFNI	CGCG	5 cut(s)	113, 120, 312, 580, 582
BspLI	GGNNCC	3 cut(s)	54, 360, 369
BspT107I	GGYRCC	1 cut(s)	367
BsrDI	GCAATG	1 cut(s)	526
BsrFI	RCCGGY	1 cut(s)	364
BsrI	ACTGG	3 cut(s)	37, 435, 517
BssAI	RCCGGY	1 cut(s)	364
BssECI	CCNNGG	4 cut(s)	7, 42, 157, 170
BssMI	GATC	1 cut(s)	397
BssNI	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
BssT1I	CCWWGG	1 cut(s)	157
Bst2UI	CCWGG	3 cut(s)	8, 384, 723
Bst4CI	ACNGT	2 cut(s)	280, 701
BstACI	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
BstBAI	YACGTR	2 cut(s)	210, 695
BstC8I	GCNNGC	2 cut(s)	639, 744
BstDEI	CTNAG	2 cut(s)	555, 627
BstF5I	GGATG	2 cut(s)	625, 670
BstFNI	CGCG	5 cut(s)	113, 120, 312, 580, 582
BstH2I	RGCGCY	3 cut(s)	223, 395, 428
BstHHI	GCGC	5 cut(s)	115, 222, 394, 427, 582
BstKTI	GATC	1 cut(s)	400
BstMAI	GTCTC	3 cut(s)	63, 88, 447
BstMBI	GATC	1 cut(s)	397
BstMCI	CGRYCG	1 cut(s)	32
BstNI	CCWGG	3 cut(s)	8, 384, 723
BstSCI	CCNGG	4 cut(s)	6, 382, 532, 721
BstSFI	CTRYAG	1 cut(s)	549
BstSNI	TACGTA	2 cut(s)	210, 695
BstUI	CGCG	5 cut(s)	113, 120, 312, 580, 582
BstV1I	GCAGC	6 cut(s)	127, 172, 215, 469, 575, 761
BstV2I	GAAGAC	1 cut(s)	67
BsuRI	GGCC	7 cut(s)	106, 180, 228, 237, 347, 434, 713
BtrI	CACGTC	1 cut(s)	610
BtsCI	GGATG	2 cut(s)	625, 670
BtsI	GCAGTG	1 cut(s)	129
BtsIMutI	CAGTG	4 cut(s)	129, 318, 442, 510
Cac8I	GCNNGC	2 cut(s)	639, 744
CaiI	CAGNNNCTG	3 cut(s)	188, 569, 755
CfoI	GCGC	5 cut(s)	115, 222, 394, 427, 582
Cfr10I	RCCGGY	1 cut(s)	364
Cfr13I	GGNCC	4 cut(s)	34, 105, 179, 346
CseI	GACGC	5 cut(s)	33, 131, 262, 485, 525
Csp6I	GTAC	1 cut(s)	211
CspAI	ACCGGT	1 cut(s)	364
CspCI	CAANNNNNGTGG	2 cut(s)	238, 273
CviAII	CATG	1 cut(s)	193
CviQI	GTAC	1 cut(s)	211
DdeI	CTNAG	2 cut(s)	555, 627
DpnI	GATC	1 cut(s)	399
DpnII	GATC	1 cut(s)	397
DrdI	GACNNNNNNGTC	1 cut(s)	107
DseDI	GACNNNNNNGTC	1 cut(s)	107
EaeI	YGGCCR	2 cut(s)	235, 711
EciI	GGCGGA	1 cut(s)	741
Eco105I	TACGTA	2 cut(s)	210, 695
Eco130I	CCWWGG	1 cut(s)	157
Eco47I	GGWCC	1 cut(s)	34
Eco47III	AGCGCT	3 cut(s)	221, 393, 426
Eco88I	CYCGRG	1 cut(s)	261
EcoRII	CCWGG	3 cut(s)	6, 382, 721
EcoT14I	CCWWGG	1 cut(s)	157
ErhI	CCWWGG	1 cut(s)	157
Esp3I	CGTCTC	1 cut(s)	63
FaeI	CATG	1 cut(s)	196
FaiI	YATR	5 cut(s)	59, 194, 354, 561, 710
FaqI	GGGAC	1 cut(s)	24
FatI	CATG	1 cut(s)	192
FauI	CCCGC	2 cut(s)	125, 585
FokI	GGATG	2 cut(s)	632, 677
FspBI	CTAG	2 cut(s)	152, 657
GlaI	GCGC	5 cut(s)	114, 221, 393, 426, 581
GsaI	CCCAGC	2 cut(s)	185, 759
GsuI	CTGGAG	3 cut(s)	366, 449, 705
HaeII	RGCGCY	3 cut(s)	223, 395, 428
HaeIII	GGCC	7 cut(s)	106, 180, 228, 237, 347, 434, 713
HapII	CCGG	4 cut(s)	32, 87, 365, 534
HgaI	GACGC	5 cut(s)	33, 131, 262, 485, 525
HhaI	GCGC	5 cut(s)	115, 222, 394, 427, 582
Hin1I	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
Hin1II	CATG	1 cut(s)	196
Hin6I	GCGC	5 cut(s)	113, 220, 392, 425, 580
HinP1I	GCGC	5 cut(s)	113, 220, 392, 425, 580
HincII	GTYRAC	1 cut(s)	574
HindII	GTYRAC	1 cut(s)	574
HinfI	GANTC	3 cut(s)	166, 245, 737
HpaI	GTTAAC	1 cut(s)	574
HpaII	CCGG	4 cut(s)	32, 87, 365, 534
HphI	GGTGA	4 cut(s)	268, 431, 617, 688
Hpy166II	GTNNAC	1 cut(s)	574
Hpy188I	TCNGA	2 cut(s)	43, 171
Hpy188III	TCNNGA	3 cut(s)	50, 299, 401
Hpy8I	GTNNAC	1 cut(s)	574
Hpy99I	CGWCG	4 cut(s)	113, 125, 479, 587
HpyAV	CCTTC	1 cut(s)	263
HpyCH4III	ACNGT	2 cut(s)	280, 701
HpyCH4IV	ACGT	5 cut(s)	72, 209, 585, 609, 694
HpyCH4V	TGCA	5 cut(s)	196, 485, 563, 623, 668
HpyF3I	CTNAG	2 cut(s)	555, 627
HpySE526I	ACGT	5 cut(s)	72, 209, 585, 609, 694
Hsp92I	GRCGYC	6 cut(s)	25, 72, 123, 273, 477, 585
Hsp92II	CATG	1 cut(s)	196
HspAI	GCGC	5 cut(s)	113, 220, 392, 425, 580
KspAI	GTTAAC	1 cut(s)	574
Kzo9I	GATC	1 cut(s)	397
LmnI	GCTCC	3 cut(s)	358, 389, 683
Lsp1109I	GCAGC	6 cut(s)	127, 172, 215, 469, 575, 761
LweI	GCATC	3 cut(s)	386, 610, 655
MaeI	CTAG	2 cut(s)	152, 657
MaeII	ACGT	5 cut(s)	72, 209, 585, 609, 694
MaeIII	GTNAC	6 cut(s)	274, 280, 316, 605, 652, 695
MalI	GATC	1 cut(s)	399
MboI	GATC	1 cut(s)	397
MboII	GAAGA	1 cut(s)	67
MfeI	CAATTG	1 cut(s)	462
MlsI	TGGCCA	2 cut(s)	237, 713
MluCI	AATT	4 cut(s)	92, 291, 408, 462
MluNI	TGGCCA	2 cut(s)	237, 713
MlyI	GAGTC	1 cut(s)	239
MnlI	CCTC	9 cut(s)	37, 165, 259, 380, 424, 530, 577, 610, 655
Mox20I	TGGCCA	2 cut(s)	237, 713
MscI	TGGCCA	2 cut(s)	237, 713
MseI	TTAA	3 cut(s)	294, 573, 762
Msp20I	TGGCCA	2 cut(s)	237, 713
MspA1I	CMGCKG	3 cut(s)	185, 482, 752
MspI	CCGG	4 cut(s)	32, 87, 365, 534
MspR9I	CCNGG	4 cut(s)	8, 384, 534, 723
MunI	CAATTG	1 cut(s)	462
MvaI	CCWGG	3 cut(s)	8, 384, 723
MvnI	CGCG	5 cut(s)	113, 120, 312, 580, 582
NciI	CCSGG	1 cut(s)	534
NdeII	GATC	1 cut(s)	397
NlaIII	CATG	1 cut(s)	196
NlaIV	GGNNCC	3 cut(s)	54, 360, 369
NmuCI	GTSAC	4 cut(s)	274, 316, 605, 652
PcsI	WCGNNNNNNNCGW	2 cut(s)	117, 206
PfeI	GAWTC	2 cut(s)	166, 737
PflMI	CCANNNNNTGG	1 cut(s)	355
PfoI	TCCNGGA	1 cut(s)	382
PinAI	ACCGGT	1 cut(s)	364
PleI	GAGTC	1 cut(s)	239
PpsI	GAGTC	1 cut(s)	239
Ppu21I	YACGTR	2 cut(s)	210, 695
PshBI	ATTAAT	1 cut(s)	294
Psp6I	CCWGG	3 cut(s)	6, 382, 721
PspFI	CCCAGC	2 cut(s)	181, 755
PspGI	CCWGG	3 cut(s)	6, 382, 721
PspN4I	GGNNCC	3 cut(s)	54, 360, 369
PspPI	GGNCC	4 cut(s)	34, 105, 179, 346
PstNI	CAGNNNCTG	3 cut(s)	188, 569, 755
PvuII	CAGCTG	1 cut(s)	185
RsaI	GTAC	1 cut(s)	212
RsaNI	GTAC	1 cut(s)	211
SaqAI	TTAA	3 cut(s)	294, 573, 762
Sau3AI	GATC	1 cut(s)	397
Sau96I	GGNCC	4 cut(s)	34, 105, 179, 346
SchI	GAGTC	1 cut(s)	239
ScrFI	CCNGG	4 cut(s)	8, 384, 534, 723
SfaNI	GCATC	3 cut(s)	386, 610, 655
SfcI	CTRYAG	1 cut(s)	549
SfiI	GGCCNNNNNGGCC	1 cut(s)	234
SgrAI	CRCCGGYG	1 cut(s)	364
SinI	GGWCC	1 cut(s)	34
SnaBI	TACGTA	2 cut(s)	210, 695
Sse9I	AATT	4 cut(s)	92, 291, 408, 462
SspMI	CTAG	2 cut(s)	152, 657
StyD4I	CCNGG	4 cut(s)	6, 382, 532, 721
StyI	CCWWGG	1 cut(s)	157
TaaI	ACNGT	2 cut(s)	280, 701
TaiI	ACGT	5 cut(s)	75, 212, 588, 612, 697
TaqI	TCGA	1 cut(s)	400
TasI	AATT	4 cut(s)	92, 291, 408, 462
TauI	GCSGC	6 cut(s)	128, 482, 497, 548, 749, 755
TfiI	GAWTC	2 cut(s)	166, 737
Tru1I	TTAA	3 cut(s)	294, 573, 762
Tru9I	TTAA	3 cut(s)	294, 573, 762
TscAI	CASTG	4 cut(s)	136, 325, 442, 517
TseFI	GTSAC	4 cut(s)	274, 316, 605, 652
TseI	GCWGC	6 cut(s)	140, 185, 203, 482, 563, 749
Tsp45I	GTSAC	4 cut(s)	274, 316, 605, 652
TspGWI	ACGGA	1 cut(s)	81
TspRI	CASTG	4 cut(s)	136, 325, 442, 517
Van91I	CCANNNNNTGG	1 cut(s)	355
VpaK11BI	GGWCC	1 cut(s)	34
VspI	ATTAAT	1 cut(s)	294
XspI	CTAG	2 cut(s)	152, 657
ZraI	GACGTC	2 cut(s)	73, 586

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.