pycom07g22500

phosphotransferase activity, carboxyl group as acceptor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
23824762 .. 23825911
1150 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g22500.5

Sequence Viewer

Length: 282 bp
ATGGCTGAGATCGATCATAAGGCATTACTAGAAGAGGTGATCTCAACTCGTACATTTAGTGGTAAATCTGTAGTCCAGGATAAAGATAAGCTAATACGCAACTTAAAGACCATCCAGGACTATCTTTGTTCATTCAATTCGCAGGGATTGACAGTTGTCAATATATCTTCAACCACATTTCCGCAAACACTGGATTGGCTGCACGGGTATCTTCTTGAGTGTATAGAGCATGGTATTTCATCAGTGTCCAATGAAAATAGTAGGCGGCCTGCGGAAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.46

Weight (kDa)

5.49

Isoelectric Point (pI)

58.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 182, 265, 272
AfaI GTAC 1 cut(s) 52
AgsI TTSAA 2 cut(s) 136, 171
AjnI CCWGG 2 cut(s) 75, 114
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AoxI GGCC 1 cut(s) 266
ApeKI GCWGC 1 cut(s) 199
AsuHPI GGTGA 1 cut(s) 49
BbvI GCAGC 1 cut(s) 186
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 2 cut(s) 77, 116
BfaI CTAG 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 69
BisI GCNGC 2 cut(s) 200, 266
BlsI GCNGC 2 cut(s) 201, 267
Bme1390I CCNGG 2 cut(s) 77, 116
BmrFI CCNGG 2 cut(s) 77, 116
BoxI GACNNNNGTC 1 cut(s) 155
BplI GAGNNNNNCTC 2 cut(s) 26, 58
BpuEI CTTGAG 1 cut(s) 236
Bsa29I ATCGAT 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 195
BseBI CCWGG 2 cut(s) 77, 116
BseCI ATCGAT 1 cut(s) 12
BseGI GGATG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 185
BshFI GGCC 1 cut(s) 268
BshVI ATCGAT 1 cut(s) 12
BsnI GGCC 1 cut(s) 268
Bsp143I GATC 3 cut(s) 9, 13, 39
BspACI CCGC 3 cut(s) 182, 265, 272
BspANI GGCC 1 cut(s) 268
BspDI ATCGAT 1 cut(s) 12
BsrI ACTGG 1 cut(s) 195
BssMI GATC 3 cut(s) 9, 13, 39
Bst2UI CCWGG 2 cut(s) 77, 116
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 270
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 3 cut(s) 12, 16, 42
BstMBI GATC 3 cut(s) 9, 13, 39
BstNI CCWGG 2 cut(s) 77, 116
BstPAI GACNNNNGTC 1 cut(s) 155
BstSCI CCNGG 2 cut(s) 75, 114
BstSFI CTRYAG 1 cut(s) 69
BstV1I GCAGC 1 cut(s) 186
Bsu15I ATCGAT 1 cut(s) 12
BsuRI GGCC 1 cut(s) 268
BsuTUI ATCGAT 1 cut(s) 12
BtsCI GGATG 1 cut(s) 111
BtsIMutI CAGTG 2 cut(s) 188, 249
Cac8I GCNNGC 1 cut(s) 270
ClaI ATCGAT 1 cut(s) 12
Csp6I GTAC 1 cut(s) 51
CviAII CATG 1 cut(s) 230
CviJI RGCY 4 cut(s) 5, 91, 199, 268
CviKI_1 RGCY 4 cut(s) 5, 91, 199, 268
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 1 cut(s) 6
DpnI GATC 3 cut(s) 11, 15, 41
DpnII GATC 3 cut(s) 9, 13, 39
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
EcoRII CCWGG 2 cut(s) 75, 114
FaeI CATG 1 cut(s) 233
FaiI YATR 4 cut(s) 18, 164, 224, 231
FatI CATG 1 cut(s) 229
Fnu4HI GCNGC 2 cut(s) 200, 266
FokI GGATG 1 cut(s) 98
Fsp4HI GCNGC 2 cut(s) 200, 266
FspBI CTAG 1 cut(s) 29
GluI GCNGC 2 cut(s) 200, 266
HaeIII GGCC 1 cut(s) 268
Hin1II CATG 1 cut(s) 233
HphI GGTGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 215
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 202
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 233
Kzo9I GATC 3 cut(s) 9, 13, 39
LpnPI CCDG 6 cut(s) 62, 89, 101, 128, 128, 176
Lsp1109I GCAGC 1 cut(s) 186
MaeI CTAG 1 cut(s) 29
MalI GATC 3 cut(s) 11, 15, 41
MboI GATC 3 cut(s) 9, 13, 39
MboII GAAGA 3 cut(s) 44, 159, 203
MluCI AATT 1 cut(s) 136
MnlI CCTC 1 cut(s) 28
MseI TTAA 1 cut(s) 104
MspR9I CCNGG 2 cut(s) 77, 116
MvaI CCWGG 2 cut(s) 77, 116
NdeII GATC 3 cut(s) 9, 13, 39
NlaIII CATG 1 cut(s) 233
PfoI TCCNGGA 2 cut(s) 75, 114
PkrI GCNGC 2 cut(s) 201, 267
PshAI GACNNNNGTC 1 cut(s) 155
Psp6I CCWGG 2 cut(s) 75, 114
PspGI CCWGG 2 cut(s) 75, 114
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SaqAI TTAA 1 cut(s) 104
SatI GCNGC 2 cut(s) 200, 266
Sau3AI GATC 3 cut(s) 9, 13, 39
ScrFI CCNGG 2 cut(s) 77, 116
SetI ASST 2 cut(s) 39, 93
SfcI CTRYAG 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 1 cut(s) 136
SsiI CCGC 3 cut(s) 182, 265, 272
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 2 cut(s) 75, 114
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 12
TasI AATT 1 cut(s) 136
TauI GCSGC 1 cut(s) 268
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TscAI CASTG 2 cut(s) 195, 249
TseI GCWGC 1 cut(s) 199
TspDTI ATGAA 3 cut(s) 120, 228, 267
TspRI CASTG 2 cut(s) 195, 249
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.