Rroxscaffold_4G00283680

phosphotransferase activity, carboxyl group as acceptor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
5546696 .. 5547150
455 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00283680.1

Sequence Viewer

Length: 234 bp
ATGGCTGAATTTGAGCACCAGGCATTGCTAGAGGAGTGGTTCACTTCTTCCACATGTAGTGATAAATGGCAAGTCCAGGATAGAGATAAGCTGATAAGCAATGTGAAGATGATTCAGGACTATCTTCACTCATTTGATTCAAAGGGACTGACAGTTCTCAACCTATCAGCAGCCACATTCGCTCAAACACTAGATTGGCTGCACGGATATATTCTTGAGGTACTTCTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.94

Weight (kDa)

4.66

Isoelectric Point (pI)

25.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 8
AfaI GTAC 1 cut(s) 222
AflIII ACRYGT 1 cut(s) 53
AgsI TTSAA 1 cut(s) 141
AjnI CCWGG 2 cut(s) 18, 75
AloI GAACNNNNNNTCC 2 cut(s) 138, 170
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 18
ApeKI GCWGC 2 cut(s) 170, 199
ApoI RAATTY 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 18
BbvI GCAGC 2 cut(s) 182, 186
BciT130I CCWGG 2 cut(s) 20, 77
BfaI CTAG 2 cut(s) 29, 191
BisI GCNGC 2 cut(s) 171, 200
BlsI GCNGC 2 cut(s) 172, 201
Bme1390I CCNGG 2 cut(s) 20, 77
BmrFI CCNGG 2 cut(s) 20, 77
Bse3DI GCAATG 2 cut(s) 23, 106
BseBI CCWGG 2 cut(s) 20, 77
BseMI GCAATG 2 cut(s) 23, 106
BseRI GAGGAG 1 cut(s) 47
BseXI GCAGC 2 cut(s) 182, 186
BsgI GTGCAG 1 cut(s) 185
BsiHKAI GWGCWC 1 cut(s) 18
BslFI GGGAC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 18
BsrDI GCAATG 2 cut(s) 23, 106
Bst2UI CCWGG 2 cut(s) 20, 77
Bst4CI ACNGT 1 cut(s) 154
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNI CCWGG 2 cut(s) 20, 77
BstNSI RCATGY 1 cut(s) 57
BstSCI CCNGG 2 cut(s) 18, 75
BstV1I GCAGC 2 cut(s) 182, 186
Csp6I GTAC 1 cut(s) 221
CviAII CATG 1 cut(s) 54
CviJI RGCY 4 cut(s) 5, 91, 173, 199
CviKI_1 RGCY 4 cut(s) 5, 91, 173, 199
CviQI GTAC 1 cut(s) 221
EcoRII CCWGG 2 cut(s) 18, 75
FaeI CATG 1 cut(s) 57
FaiI YATR 2 cut(s) 55, 210
FaqI GGGAC 1 cut(s) 159
FatI CATG 1 cut(s) 53
Fnu4HI GCNGC 2 cut(s) 171, 200
Fsp4HI GCNGC 2 cut(s) 171, 200
FspBI CTAG 2 cut(s) 29, 191
GluI GCNGC 2 cut(s) 171, 200
Hin1II CATG 1 cut(s) 57
HinfI GANTC 2 cut(s) 112, 137
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 116, 215
Hpy8I GTNNAC 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
Hsp92II CATG 1 cut(s) 57
LpnPI CCDG 5 cut(s) 5, 32, 62, 89, 101
Lsp1109I GCAGC 2 cut(s) 182, 186
MaeI CTAG 2 cut(s) 29, 191
MboII GAAGA 3 cut(s) 39, 116, 118
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 2 cut(s) 8, 229
MnlI CCTC 2 cut(s) 25, 211
MseI TTAA 2 cut(s) 228, 232
MspR9I CCNGG 2 cut(s) 20, 77
MvaI CCWGG 2 cut(s) 20, 77
MwoI GCNNNNNNNGC 1 cut(s) 179
NlaIII CATG 1 cut(s) 57
NspI RCATGY 1 cut(s) 57
PacI TTAATTAA 1 cut(s) 232
PciI ACATGT 1 cut(s) 53
PfeI GAWTC 2 cut(s) 112, 137
PfoI TCCNGGA 1 cut(s) 75
PkrI GCNGC 2 cut(s) 172, 201
PscI ACATGT 1 cut(s) 53
Psp6I CCWGG 2 cut(s) 18, 75
PspGI CCWGG 2 cut(s) 18, 75
RsaI GTAC 1 cut(s) 222
RsaNI GTAC 1 cut(s) 221
SaqAI TTAA 2 cut(s) 228, 232
SatI GCNGC 2 cut(s) 171, 200
ScrFI CCNGG 2 cut(s) 20, 77
SduI GDGCHC 1 cut(s) 18
SetI ASST 3 cut(s) 93, 165, 222
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 2 cut(s) 8, 229
SspMI CTAG 2 cut(s) 29, 191
StyD4I CCNGG 2 cut(s) 18, 75
TaaI ACNGT 1 cut(s) 154
TasI AATT 2 cut(s) 8, 229
TfiI GAWTC 2 cut(s) 112, 137
Tru1I TTAA 2 cut(s) 228, 232
Tru9I TTAA 2 cut(s) 228, 232
TseI GCWGC 2 cut(s) 170, 199
TspGWI ACGGA 1 cut(s) 219
XapI RAATTY 1 cut(s) 8
XceI RCATGY 1 cut(s) 57
XspI CTAG 2 cut(s) 29, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.