Rorug01G0097200

phosphotransferase activity, carboxyl group as acceptor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
16065235 .. 16065694
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0097200.1

Sequence Viewer

Length: 336 bp
ATGATTCTTCTGATACAGATAGCAGTGCAGAGGTATGATTCAGAAGAAGATGATTCTGAAGTTGATGTTGACAAGAAGCAGAAGGTTGAAAAGAAGCATAGTAAAAGGCGAAACAATAGAGCTGATGATTCTGTTACCAGTGGTGATGTGGAGGCCAGATCCAGAAACGAAATTAAGAAATCTAAACGACCCTGTAGGAGGCATGATTCAGATGAAGATGATGTTGACAAGAAGAGGAAGGTTGTAATGAAGCATAATAAGACTAGAAACGATGATACTGATGATGATTCTGCTGCCAGTGAAGATGCCGAGGATAGATCCACAAAGGAAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.92

Weight (kDa)

5.67

Isoelectric Point (pI)

68.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 153, 312
AcuI CTGAAG 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 198
AgsI TTSAA 1 cut(s) 89
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AlwI GGATC 2 cut(s) 153, 312
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 1 cut(s) 293
AsuHPI GGTGA 1 cut(s) 155
BbvI GCAGC 1 cut(s) 280
BfaI CTAG 2 cut(s) 264, 334
BfmI CTRYAG 1 cut(s) 193
BisI GCNGC 1 cut(s) 294
BlsI GCNGC 1 cut(s) 295
BmsI GCATC 1 cut(s) 295
BsaJI CCNNGG 1 cut(s) 309
Bsc4I CCNNNNNNNGG 1 cut(s) 198
Bse1I ACTGG 2 cut(s) 138, 297
BseDI CCNNGG 1 cut(s) 309
BseLI CCNNNNNNNGG 1 cut(s) 198
BseNI ACTGG 2 cut(s) 138, 297
BseXI GCAGC 1 cut(s) 280
BsgI GTGCAG 1 cut(s) 47
BshFI GGCC 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 198
BsnI GGCC 1 cut(s) 155
Bsp143I GATC 2 cut(s) 158, 317
BspANI GGCC 1 cut(s) 155
BspPI GGATC 2 cut(s) 153, 312
BsrI ACTGG 2 cut(s) 138, 297
BssECI CCNNGG 1 cut(s) 309
BssMI GATC 2 cut(s) 158, 317
Bst6I CTCTTC 1 cut(s) 227
BstENI CCTNNNNNAGG 1 cut(s) 196
BstKTI GATC 2 cut(s) 161, 320
BstMBI GATC 2 cut(s) 158, 317
BstSFI CTRYAG 1 cut(s) 193
BstV1I GCAGC 1 cut(s) 280
BstX2I RGATCY 2 cut(s) 158, 317
BstYI RGATCY 2 cut(s) 158, 317
BsuRI GGCC 1 cut(s) 155
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 3 cut(s) 30, 145, 304
CviAII CATG 1 cut(s) 203
CviJI RGCY 2 cut(s) 122, 155
CviKI_1 RGCY 2 cut(s) 122, 155
DpnI GATC 2 cut(s) 160, 319
DpnII GATC 2 cut(s) 158, 317
Eam1104I CTCTTC 1 cut(s) 227
EarI CTCTTC 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 78
EcoNI CCTNNNNNAGG 1 cut(s) 196
FaeI CATG 1 cut(s) 206
FaiI YATR 4 cut(s) 36, 99, 204, 255
FatI CATG 1 cut(s) 202
Fnu4HI GCNGC 1 cut(s) 294
Fsp4HI GCNGC 1 cut(s) 294
FspBI CTAG 2 cut(s) 264, 334
GluI GCNGC 1 cut(s) 294
HaeIII GGCC 1 cut(s) 155
Hin1II CATG 1 cut(s) 206
HincII GTYRAC 2 cut(s) 70, 226
HindII GTYRAC 2 cut(s) 70, 226
HinfI GANTC 6 cut(s) 4, 38, 53, 128, 206, 287
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 2 cut(s) 70, 226
Hpy188I TCNGA 4 cut(s) 12, 43, 58, 211
Hpy188III TCNNGA 1 cut(s) 162
Hpy8I GTNNAC 2 cut(s) 70, 226
HpyAV CCTTC 2 cut(s) 76, 232
HpyCH4V TGCA 1 cut(s) 28
Hsp92II CATG 1 cut(s) 206
Kzo9I GATC 2 cut(s) 158, 317
LpnPI CCDG 5 cut(s) 151, 169, 175, 205, 310
Lsp1109I GCAGC 1 cut(s) 280
LweI GCATC 1 cut(s) 295
MaeI CTAG 2 cut(s) 264, 334
MaeIII GTNAC 1 cut(s) 133
MalI GATC 2 cut(s) 160, 319
MboI GATC 2 cut(s) 158, 317
MboII GAAGA 5 cut(s) 56, 59, 227, 244, 314
MflI RGATCY 2 cut(s) 158, 317
MluCI AATT 1 cut(s) 171
MnlI CCTC 5 cut(s) 24, 145, 192, 228, 304
MseI TTAA 1 cut(s) 174
NdeII GATC 2 cut(s) 158, 317
NlaIII CATG 1 cut(s) 206
NmeAIII GCCGAG 1 cut(s) 334
PfeI GAWTC 6 cut(s) 4, 38, 53, 128, 206, 287
PkrI GCNGC 1 cut(s) 295
PsuI RGATCY 2 cut(s) 158, 317
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 294
Sau3AI GATC 2 cut(s) 158, 317
SetI ASST 4 cut(s) 35, 87, 124, 243
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 1 cut(s) 193
Sse9I AATT 1 cut(s) 171
SspMI CTAG 2 cut(s) 264, 334
TasI AATT 1 cut(s) 171
TfiI GAWTC 6 cut(s) 4, 38, 53, 128, 206, 287
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 3 cut(s) 30, 145, 304
TseI GCWGC 1 cut(s) 293
TspDTI ATGAA 2 cut(s) 228, 263
TspRI CASTG 3 cut(s) 30, 145, 304
XagI CCTNNNNNAGG 1 cut(s) 196
XcmI CCANNNNNNNNNTGG 1 cut(s) 145
XspI CTAG 2 cut(s) 264, 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.