pycom15g17890
MYB Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0002896
Physical Location & Seq
Forward (+)
12720593 .. 12721261
669 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g17890.2

Sequence Viewer

Length: 546 bp
ATGACAAACAAAACCAATTACAAACTTTTTTATAGACGGCAAATTGTTCGTTTGGTGTGGTCTATTATAGCTTCTCAACTTCCAGGAAGAACTGACAATGATATTAAAAACTATTGGAACACCAAATTGAAGAAAAAACTCTTGGCAACAAACAACATGAACACCGTTGATACCAACTTATCACAGTTTTCGGATTCGATTCCGAAAACTGAAACCCTACATGACCAGGGAACACCATCGTGTTTTGATGGGACATTGCCATATCTAAAGGATGTAAGCTCGGGGCAAAGCTTTGATCCCTGCACTCAAATTTCTCCTTCAAATCCTATGGAAGTTAATGGCTTTGAGACTAGAGAAGACAAGAGTTTCAGCATTATTTCACCATCTCAAGAAGTTTCAAGCCTTCCAACTTCATCTGGTTTGGGTTTGGAGAACAATTACAGCATCTGGTCTGGCAATGAAGGTGTCGATAATGTCAGTGGGGTTCTTATGCCCTTTGGATTTGAGCCTCCTAATGATGATCTTCTGGATGGCTTTGGTTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

182

Amino Acids

20.16

Weight (kDa)

4.73

Isoelectric Point (pI)

36.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 290
AcsI RAATTY 1 cut(s) 309
AgsI TTSAA 3 cut(s) 130, 321, 399
AjnI CCWGG 2 cut(s) 82, 225
AjuI GAANNNNNNNTTGG 2 cut(s) 125, 157
AleI CACNNNNGTG 1 cut(s) 238
AluBI AGCT 3 cut(s) 71, 279, 291
AluI AGCT 3 cut(s) 71, 279, 291
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 1 cut(s) 290
AlwNI CAGNNNCTG 1 cut(s) 447
Ama87I CYCGRG 1 cut(s) 280
ApoI RAATTY 1 cut(s) 309
AsuHPI GGTGA 1 cut(s) 372
AvaI CYCGRG 1 cut(s) 280
BbsI GAAGAC 1 cut(s) 363
BccI CCATC 4 cut(s) 242, 244, 391, 524
BceAI ACGGC 1 cut(s) 53
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BciT130I CCWGG 2 cut(s) 84, 227
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 1 cut(s) 351
Bme1390I CCNGG 2 cut(s) 84, 227
BmeT110I CYCGRG 1 cut(s) 280
BmrFI CCNGG 2 cut(s) 84, 227
BmsI GCATC 1 cut(s) 453
BpiI GAAGAC 1 cut(s) 363
BpuEI CTTGAG 1 cut(s) 372
BsaJI CCNNGG 1 cut(s) 226
Bse3DI GCAATG 2 cut(s) 254, 463
BseBI CCWGG 2 cut(s) 84, 227
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 2 cut(s) 277, 535
BseMI GCAATG 2 cut(s) 254, 463
BsgI GTGCAG 1 cut(s) 286
BsiHKCI CYCGRG 1 cut(s) 280
BslFI GGGAC 1 cut(s) 265
BsmAI GTCTC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 265
BsoBI CYCGRG 1 cut(s) 280
Bsp143I GATC 2 cut(s) 295, 520
BspPI GGATC 1 cut(s) 290
BsrDI GCAATG 2 cut(s) 254, 463
BssECI CCNNGG 1 cut(s) 226
BssMI GATC 2 cut(s) 295, 520
Bst2UI CCWGG 2 cut(s) 84, 227
Bst4CI ACNGT 2 cut(s) 166, 186
BstF5I GGATG 2 cut(s) 277, 535
BstKTI GATC 2 cut(s) 298, 523
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 2 cut(s) 295, 520
BstNI CCWGG 2 cut(s) 84, 227
BstSCI CCNGG 2 cut(s) 82, 225
BstV2I GAAGAC 1 cut(s) 363
BtsCI GGATG 2 cut(s) 277, 535
BtsIMutI CAGTG 1 cut(s) 484
CaiI CAGNNNCTG 1 cut(s) 447
CviAII CATG 2 cut(s) 157, 221
CviJI RGCY 7 cut(s) 71, 279, 291, 342, 402, 508, 534
CviKI_1 RGCY 7 cut(s) 71, 279, 291, 342, 402, 508, 534
DpnI GATC 2 cut(s) 297, 522
DpnII GATC 2 cut(s) 295, 520
Eco88I CYCGRG 1 cut(s) 280
EcoRII CCWGG 2 cut(s) 82, 225
FaeI CATG 2 cut(s) 160, 224
FaiI YATR 7 cut(s) 33, 68, 158, 222, 262, 329, 491
FaqI GGGAC 1 cut(s) 265
FatI CATG 2 cut(s) 156, 220
FokI GGATG 2 cut(s) 284, 542
FspBI CTAG 1 cut(s) 351
Hin1II CATG 2 cut(s) 160, 224
HindIII AAGCTT 1 cut(s) 289
HinfI GANTC 2 cut(s) 194, 199
HphI GGTGA 1 cut(s) 372
Hpy188I TCNGA 2 cut(s) 193, 204
Hpy188III TCNNGA 2 cut(s) 389, 527
HpyAV CCTTC 3 cut(s) 327, 413, 455
HpyCH4III ACNGT 2 cut(s) 166, 186
HpyCH4V TGCA 1 cut(s) 303
Hsp92II CATG 2 cut(s) 160, 224
Kzo9I GATC 2 cut(s) 295, 520
LpnPI CCDG 9 cut(s) 69, 96, 212, 239, 313, 402, 433, 438, 512
LweI GCATC 1 cut(s) 453
MaeI CTAG 1 cut(s) 351
MalI GATC 2 cut(s) 297, 522
MboI GATC 2 cut(s) 295, 520
MboII GAAGA 4 cut(s) 99, 142, 368, 515
MluCI AATT 5 cut(s) 16, 42, 125, 309, 436
MmeI TCCRAC 1 cut(s) 431
MnlI CCTC 1 cut(s) 519
MseI TTAA 3 cut(s) 105, 336, 544
MslI CAYNNNNRTG 1 cut(s) 238
MspR9I CCNGG 2 cut(s) 84, 227
MvaI CCWGG 2 cut(s) 84, 227
NdeII GATC 2 cut(s) 295, 520
NlaIII CATG 2 cut(s) 160, 224
OliI CACNNNNGTG 1 cut(s) 238
PfeI GAWTC 2 cut(s) 194, 199
PfoI TCCNGGA 1 cut(s) 82
Psp6I CCWGG 2 cut(s) 82, 225
PspGI CCWGG 2 cut(s) 82, 225
PstNI CAGNNNCTG 1 cut(s) 447
RseI CAYNNNNRTG 1 cut(s) 238
SaqAI TTAA 3 cut(s) 105, 336, 544
Sau3AI GATC 2 cut(s) 295, 520
ScrFI CCNGG 2 cut(s) 84, 227
SetI ASST 4 cut(s) 73, 281, 293, 466
SfaNI GCATC 1 cut(s) 453
SmiMI CAYNNNNRTG 1 cut(s) 238
SmlI CTYRAG 1 cut(s) 387
SmoI CTYRAG 1 cut(s) 387
Sse9I AATT 5 cut(s) 16, 42, 125, 309, 436
SspMI CTAG 1 cut(s) 351
StyD4I CCNGG 2 cut(s) 82, 225
TaaI ACNGT 2 cut(s) 166, 186
TaqI TCGA 2 cut(s) 197, 468
TasI AATT 5 cut(s) 16, 42, 125, 309, 436
TfiI GAWTC 2 cut(s) 194, 199
Tru1I TTAA 3 cut(s) 105, 336, 544
Tru9I TTAA 3 cut(s) 105, 336, 544
TscAI CASTG 1 cut(s) 484
TspDTI ATGAA 3 cut(s) 173, 402, 474
TspRI CASTG 1 cut(s) 484
XapI RAATTY 1 cut(s) 309
XspI CTAG 1 cut(s) 351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.