pycom461g00270

PHD finger protein MALE

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000461
Physical Location & Seq
Reverse (-)
222039 .. 222314
276 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom461g00270.1

Sequence Viewer

Length: 276 bp
ATGACTAGGCAGGAAGCTAGAGATGCAGCTCGCCTGCACATTGGCGATACGTGTTTGCTGGATTATGAAATCGAACAACGTAATTGTTGGAGGTTACATTGTCCGTCGTGGTGTGATGTGAACTCATTAACTAGGGTTTTAAAATACTCAATCAAGGAGCCTGGGAATGGTGTTCAGGTTGATGAGCCGGAACCTGAGATAGTTTACAATGAACCACTACCCATACCAGAAAGATTGCCTGGGGAATATAGATGCCTAAGTGATTCCTTAGCTTAG

Protein Analysis

92

Amino Acids

10.51

Weight (kDa)

4.79

Isoelectric Point (pI)

50.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_plant_repro PF25874 1 - 53 1.3e-08 Winged helix-turn-helix domain in plant reproductive proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 167
AflIII ACRYGT 1 cut(s) 50
AjnI CCWGG 2 cut(s) 160, 238
AluBI AGCT 3 cut(s) 17, 29, 272
AluI AGCT 3 cut(s) 17, 29, 272
ApeKI GCWGC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 38
BciT130I CCWGG 2 cut(s) 162, 240
BfaI CTAG 3 cut(s) 6, 18, 132
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
Bme1390I CCNGG 2 cut(s) 162, 240
BmiI GGNNCC 2 cut(s) 159, 192
BmrFI CCNGG 2 cut(s) 162, 240
BmsI GCATC 2 cut(s) 13, 242
Bpu10I CCTNAGC 1 cut(s) 268
BsaAI YACGTR 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 161, 239
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 2 cut(s) 162, 240
BseDI CCNNGG 2 cut(s) 161, 239
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 186
BseXI GCAGC 1 cut(s) 38
BsgI GTGCAG 1 cut(s) 20
BsiSI CCGG 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 187
BspLI GGNNCC 2 cut(s) 159, 192
BssECI CCNNGG 2 cut(s) 161, 239
Bst2UI CCWGG 2 cut(s) 162, 240
BstBAI YACGTR 1 cut(s) 51
BstC8I GCNNGC 2 cut(s) 31, 35
BstDEI CTNAG 4 cut(s) 195, 257, 268, 273
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNI CCWGG 2 cut(s) 162, 240
BstSCI CCNGG 2 cut(s) 160, 238
BstV1I GCAGC 1 cut(s) 38
Cac8I GCNNGC 2 cut(s) 31, 35
CviJI RGCY 5 cut(s) 17, 29, 160, 187, 272
CviKI_1 RGCY 5 cut(s) 17, 29, 160, 187, 272
DdeI CTNAG 4 cut(s) 195, 257, 268, 273
DraI TTTAAA 1 cut(s) 141
EcoRII CCWGG 2 cut(s) 160, 238
FaiI YATR 3 cut(s) 66, 224, 249
Fnu4HI GCNGC 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 27
FspBI CTAG 3 cut(s) 6, 18, 132
GluI GCNGC 1 cut(s) 27
HapII CCGG 1 cut(s) 188
HinfI GANTC 1 cut(s) 263
HpaII CCGG 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 121, 205
Hpy8I GTNNAC 2 cut(s) 121, 205
Hpy99I CGWCG 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 50, 79
HpyCH4V TGCA 2 cut(s) 26, 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
HpyF3I CTNAG 4 cut(s) 195, 257, 268, 273
HpySE526I ACGT 2 cut(s) 50, 79
LmnI GCTCC 1 cut(s) 157
Lsp1109I GCAGC 1 cut(s) 38
LweI GCATC 2 cut(s) 13, 242
MaeI CTAG 3 cut(s) 6, 18, 132
MaeII ACGT 2 cut(s) 50, 79
MaeIII GTNAC 1 cut(s) 93
MluCI AATT 1 cut(s) 82
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 1 cut(s) 84
MseI TTAA 2 cut(s) 128, 140
MspI CCGG 1 cut(s) 188
MspR9I CCNGG 2 cut(s) 162, 240
MvaI CCWGG 2 cut(s) 162, 240
MwoI GCNNNNNNNGC 1 cut(s) 23
NlaIV GGNNCC 2 cut(s) 159, 192
PfeI GAWTC 1 cut(s) 263
PkrI GCNGC 1 cut(s) 28
Ppu21I YACGTR 1 cut(s) 51
Psp6I CCWGG 2 cut(s) 160, 238
PspGI CCWGG 2 cut(s) 160, 238
PspN4I GGNNCC 2 cut(s) 159, 192
SaqAI TTAA 2 cut(s) 128, 140
SatI GCNGC 1 cut(s) 27
ScrFI CCNGG 2 cut(s) 162, 240
SetI ASST 8 cut(s) 19, 31, 53, 82, 95, 180, 196, 274
SfaNI GCATC 2 cut(s) 13, 242
Sse9I AATT 1 cut(s) 82
SspMI CTAG 3 cut(s) 6, 18, 132
StyD4I CCNGG 2 cut(s) 160, 238
TaiI ACGT 2 cut(s) 53, 82
TaqI TCGA 1 cut(s) 72
TasI AATT 1 cut(s) 82
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 2 cut(s) 128, 140
Tru9I TTAA 2 cut(s) 128, 140
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 2 cut(s) 81, 225
TspGWI ACGGA 1 cut(s) 93
XspI CTAG 3 cut(s) 6, 18, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.