RchiOBHm_Chr4g0407941

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
30248701 .. 30253037
4337 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGCTAGAGCCATTCCTTGATCCCGCTGTAGGCAAATTCAAGGGTAAAATAGCCTTTGGAGATCTATCTTGTGCATATCTAGAAACGCAGGAACGGAATTGTGCTATTGCTATTAATGTGATTCGTACAGCAGTGCATAAACCAGCAGTTCTTCCTTCACTAGAATCTGAATGGAGGCATGGATCAGTTGCTCCTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.25

Weight (kDa)

7.83

Isoelectric Point (pI)

35.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AclWI GGATC 2 cut(s) 14, 190
AcsI RAATTY 1 cut(s) 35
AfaI GTAC 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 40
AlwI GGATC 2 cut(s) 14, 190
ApoI RAATTY 1 cut(s) 35
AseI ATTAAT 1 cut(s) 114
AspA2I CCTAGG 1 cut(s) 194
AvrII CCTAGG 1 cut(s) 194
BfaI CTAG 4 cut(s) 5, 80, 161, 195
BfmI CTRYAG 1 cut(s) 27
BglII AGATCT 1 cut(s) 61
BlnI CCTAGG 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 29
Bsp143I GATC 3 cut(s) 19, 61, 182
BspACI CCGC 1 cut(s) 24
BspPI GGATC 2 cut(s) 14, 190
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 3 cut(s) 19, 61, 182
BssT1I CCWWGG 1 cut(s) 194
BstKTI GATC 3 cut(s) 22, 64, 185
BstMBI GATC 3 cut(s) 19, 61, 182
BstSFI CTRYAG 1 cut(s) 27
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BtsI GCAGTG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 138
Csp6I GTAC 1 cut(s) 126
CviAII CATG 1 cut(s) 179
CviJI RGCY 2 cut(s) 10, 53
CviKI_1 RGCY 2 cut(s) 10, 53
CviQI GTAC 1 cut(s) 126
DpnI GATC 3 cut(s) 21, 63, 184
DpnII GATC 3 cut(s) 19, 61, 182
Eco130I CCWWGG 1 cut(s) 194
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 1 cut(s) 182
FaiI YATR 3 cut(s) 76, 138, 180
FatI CATG 1 cut(s) 178
FauI CCCGC 1 cut(s) 31
FspBI CTAG 4 cut(s) 5, 80, 161, 195
Hin1II CATG 1 cut(s) 182
HinfI GANTC 2 cut(s) 121, 164
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 165
HpyCH4V TGCA 2 cut(s) 74, 136
Hsp92II CATG 1 cut(s) 182
Kzo9I GATC 3 cut(s) 19, 61, 182
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 2 cut(s) 74, 156
MaeI CTAG 4 cut(s) 5, 80, 161, 195
MalI GATC 3 cut(s) 21, 63, 184
MboI GATC 3 cut(s) 19, 61, 182
MboII GAAGA 1 cut(s) 143
MflI RGATCY 1 cut(s) 61
MluCI AATT 2 cut(s) 35, 97
MnlI CCTC 1 cut(s) 168
MseI TTAA 1 cut(s) 114
MspA1I CMGCKG 1 cut(s) 26
NdeII GATC 3 cut(s) 19, 61, 182
NlaIII CATG 1 cut(s) 182
PfeI GAWTC 2 cut(s) 121, 164
PshBI ATTAAT 1 cut(s) 114
PsuI RGATCY 1 cut(s) 61
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 3 cut(s) 19, 61, 182
SetI ASST 1 cut(s) 200
SfcI CTRYAG 1 cut(s) 27
Sse9I AATT 2 cut(s) 35, 97
SsiI CCGC 1 cut(s) 24
SspMI CTAG 4 cut(s) 5, 80, 161, 195
StyI CCWWGG 1 cut(s) 194
TasI AATT 2 cut(s) 35, 97
TfiI GAWTC 2 cut(s) 121, 164
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 109
TspRI CASTG 1 cut(s) 138
VspI ATTAAT 1 cut(s) 114
XapI RAATTY 1 cut(s) 35
XbaI TCTAGA 1 cut(s) 79
XmaJI CCTAGG 1 cut(s) 194
XspI CTAG 4 cut(s) 5, 80, 161, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.