RchiOBHm_Chr4g0408121

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
30554826 .. 30555357
532 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGATGATATCCTGGGAAAGTATAAGGAACTTAAACACATGATACTGTTTCTTTTAGAGATGCTAGAGCCATTCCTTGATCCCGCTGTAGGCAGATTCAAGGGTAAAATAGCCTTTGGAGATCTATCTTGTGCATATCCAGAAACGCAGGAACGGAATTGTGCTATTGCTATTAATGTGATCTGTACAGCAGTTCTTCCTTCACTAGAATCTGAATGGAGGTGTGGATCAGTTGCTCCTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.07

Weight (kDa)

5.26

Isoelectric Point (pI)

37.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 84
AclWI GGATC 2 cut(s) 74, 235
AfaI GTAC 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 89
AgsI TTSAA 1 cut(s) 100
AjnI CCWGG 1 cut(s) 12
AlwI GGATC 2 cut(s) 74, 235
AseI ATTAAT 1 cut(s) 174
AspA2I CCTAGG 1 cut(s) 239
AvrII CCTAGG 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 3 cut(s) 65, 206, 240
BfmI CTRYAG 1 cut(s) 87
BglII AGATCT 1 cut(s) 121
BlnI CCTAGG 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 14
BmsI GCATC 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 13, 239
Bsc4I CCNNNNNNNGG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 2 cut(s) 13, 239
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 89
Bsp1407I TGTACA 1 cut(s) 185
Bsp143I GATC 4 cut(s) 79, 121, 180, 227
BspACI CCGC 1 cut(s) 84
BspPI GGATC 2 cut(s) 74, 235
BsrGI TGTACA 1 cut(s) 185
BssECI CCNNGG 2 cut(s) 13, 239
BssMI GATC 4 cut(s) 79, 121, 180, 227
BssT1I CCWWGG 1 cut(s) 239
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 48
BstAUI TGTACA 1 cut(s) 185
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 4 cut(s) 82, 124, 183, 230
BstMBI GATC 4 cut(s) 79, 121, 180, 227
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 87
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 1 cut(s) 186
CviAII CATG 1 cut(s) 40
CviJI RGCY 2 cut(s) 70, 113
CviKI_1 RGCY 2 cut(s) 70, 113
CviQI GTAC 1 cut(s) 186
DpnI GATC 4 cut(s) 81, 123, 182, 229
DpnII GATC 4 cut(s) 79, 121, 180, 227
Eco130I CCWWGG 1 cut(s) 239
Eco32I GATATC 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 12
EcoRV GATATC 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 1 cut(s) 43
FaiI YATR 3 cut(s) 24, 41, 136
FatI CATG 1 cut(s) 39
FauI CCCGC 1 cut(s) 91
FokI GGATG 1 cut(s) 17
FspBI CTAG 3 cut(s) 65, 206, 240
Hin1II CATG 1 cut(s) 43
HinfI GANTC 2 cut(s) 96, 209
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 210
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 134
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 4 cut(s) 79, 121, 180, 227
LmnI GCTCC 1 cut(s) 241
LpnPI CCDG 3 cut(s) 26, 134, 153
LweI GCATC 1 cut(s) 51
MaeI CTAG 3 cut(s) 65, 206, 240
MalI GATC 4 cut(s) 81, 123, 182, 229
MboI GATC 4 cut(s) 79, 121, 180, 227
MboII GAAGA 1 cut(s) 188
MflI RGATCY 1 cut(s) 121
MluCI AATT 1 cut(s) 157
MnlI CCTC 1 cut(s) 213
MseI TTAA 2 cut(s) 33, 174
MspA1I CMGCKG 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
NdeII GATC 4 cut(s) 79, 121, 180, 227
NlaIII CATG 1 cut(s) 43
PfeI GAWTC 2 cut(s) 96, 209
PshBI ATTAAT 1 cut(s) 174
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PsuI RGATCY 1 cut(s) 121
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 2 cut(s) 33, 174
Sau3AI GATC 4 cut(s) 79, 121, 180, 227
ScrFI CCNGG 1 cut(s) 14
SetI ASST 2 cut(s) 224, 245
SfaNI GCATC 1 cut(s) 51
SfcI CTRYAG 1 cut(s) 87
Sse9I AATT 1 cut(s) 157
SsiI CCGC 1 cut(s) 84
SspMI CTAG 3 cut(s) 65, 206, 240
StyD4I CCNGG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 239
TaaI ACNGT 1 cut(s) 48
TasI AATT 1 cut(s) 157
TatI WGTACW 1 cut(s) 185
TfiI GAWTC 2 cut(s) 96, 209
Tru1I TTAA 2 cut(s) 33, 174
Tru9I TTAA 2 cut(s) 33, 174
TspGWI ACGGA 1 cut(s) 169
VspI ATTAAT 1 cut(s) 174
XmaJI CCTAGG 1 cut(s) 239
XspI CTAG 3 cut(s) 65, 206, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.