RchiOBHm_Chr4g0418871

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
44320582 .. 44326074
5493 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
ATGAAAAATGTATACCACATTCAACCAAACATTAAGCATTATGGTTGTATGGTGGATCTCCTGGGTAGAGCTGGCCGAGTAGAAGATGCTGAGAAAATGATAAGAAGCATGCCCATGAAGGCTGATGTTGTGATATGGGGCACATTGTTGGCCGCATGTACAACACATGGGAATCTAGAAATAGGAGAAATGGCTGAAAAGAATTTGACACTGTTGGATCCATCTCATGGGGCAAGTACAGTTCTCATGCCCAACCTACTTGTAGATGCAGGGAAGTGGGAGGAAGCCTCTTTGGAAAGGTGA

Protein Analysis

100

Amino Acids

11.05

Weight (kDa)

5.73

Isoelectric Point (pI)

49.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 7 - 37 1e-05 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 227
AccI GTMKAC 1 cut(s) 12
AciI CCGC 1 cut(s) 153
AclWI GGATC 3 cut(s) 63, 212, 225
AcoI YGGCCR 2 cut(s) 73, 150
AcsI RAATTY 1 cut(s) 202
AfaI GTAC 2 cut(s) 160, 238
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 1 cut(s) 23
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AlwI GGATC 3 cut(s) 63, 212, 225
AoxI GGCC 2 cut(s) 73, 150
ApoI RAATTY 1 cut(s) 202
BaeGI GKGCMC 1 cut(s) 143
BamHI GGATCC 1 cut(s) 217
BccI CCATC 1 cut(s) 229
BciT130I CCWGG 1 cut(s) 62
BfaI CTAG 1 cut(s) 176
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 62
BmiI GGNNCC 1 cut(s) 219
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 2 cut(s) 76, 256
BplI GAGNNNNNCTC 1 cut(s) 272
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 227
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 227
BseMII CTCAG 1 cut(s) 81
BseSI GKGCMC 1 cut(s) 143
BshFI GGCC 2 cut(s) 75, 152
BslI CCNNNNNNNGG 1 cut(s) 227
BsnI GGCC 2 cut(s) 75, 152
Bsp1286I GDGCHC 1 cut(s) 143
Bsp1407I TGTACA 1 cut(s) 158
Bsp143I GATC 2 cut(s) 55, 217
BspACI CCGC 1 cut(s) 153
BspANI GGCC 2 cut(s) 75, 152
BspCNI CTCAG 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 219
BspPI GGATC 3 cut(s) 63, 212, 225
BsrGI TGTACA 1 cut(s) 158
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 2 cut(s) 55, 217
BssNAI GTATAC 1 cut(s) 13
Bst1107I GTATAC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 62
Bst4CI ACNGT 2 cut(s) 213, 241
BstAUI TGTACA 1 cut(s) 158
BstC8I GCNNGC 2 cut(s) 73, 110
BstDEI CTNAG 1 cut(s) 90
BstKTI GATC 2 cut(s) 58, 220
BstMBI GATC 2 cut(s) 55, 217
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 2 cut(s) 112, 159
BstSCI CCNGG 1 cut(s) 60
BstSLI GKGCMC 1 cut(s) 143
BstX2I RGATCY 2 cut(s) 55, 217
BstYI RGATCY 2 cut(s) 55, 217
BstZ17I GTATAC 1 cut(s) 13
BsuRI GGCC 2 cut(s) 75, 152
BtsIMutI CAGTG 1 cut(s) 209
Cac8I GCNNGC 2 cut(s) 73, 110
Csp6I GTAC 2 cut(s) 159, 237
CviAII CATG 6 cut(s) 109, 115, 156, 167, 227, 247
CviJI RGCY 6 cut(s) 71, 75, 122, 152, 194, 287
CviKI_1 RGCY 6 cut(s) 71, 75, 122, 152, 194, 287
CviQI GTAC 2 cut(s) 159, 237
DdeI CTNAG 1 cut(s) 90
DpnI GATC 2 cut(s) 57, 219
DpnII GATC 2 cut(s) 55, 217
EaeI YGGCCR 2 cut(s) 73, 150
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 6 cut(s) 112, 118, 159, 170, 230, 250
FatI CATG 6 cut(s) 108, 114, 155, 166, 226, 246
FblI GTMKAC 1 cut(s) 12
Fnu4HI GCNGC 1 cut(s) 153
Fsp4HI GCNGC 1 cut(s) 153
FspBI CTAG 1 cut(s) 176
GluI GCNGC 1 cut(s) 153
HaeIII GGCC 2 cut(s) 75, 152
Hin1II CATG 6 cut(s) 112, 118, 159, 170, 230, 250
HinfI GANTC 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 112
HpyCH4III ACNGT 2 cut(s) 213, 241
HpyCH4V TGCA 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 6 cut(s) 112, 118, 159, 170, 230, 250
Kzo9I GATC 2 cut(s) 55, 217
LpnPI CCDG 4 cut(s) 47, 57, 74, 255
LweI GCATC 2 cut(s) 76, 256
MaeI CTAG 1 cut(s) 176
MalI GATC 2 cut(s) 57, 219
MboI GATC 2 cut(s) 55, 217
MboII GAAGA 1 cut(s) 95
MflI RGATCY 2 cut(s) 55, 217
MhlI GDGCHC 1 cut(s) 143
MluCI AATT 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 195
MnlI CCTC 2 cut(s) 274, 298
MseI TTAA 1 cut(s) 33
MslI CAYNNNNRTG 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeII GATC 2 cut(s) 55, 217
NlaIII CATG 6 cut(s) 112, 118, 159, 170, 230, 250
NlaIV GGNNCC 1 cut(s) 219
NmeAIII GCCGAG 1 cut(s) 101
NspI RCATGY 2 cut(s) 112, 159
PaeI GCATGC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 172
PflMI CCANNNNNTGG 1 cut(s) 227
PkrI GCNGC 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 219
PsuI RGATCY 2 cut(s) 55, 217
RsaI GTAC 2 cut(s) 160, 238
RsaNI GTAC 2 cut(s) 159, 237
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 33
SatI GCNGC 1 cut(s) 153
Sau3AI GATC 2 cut(s) 55, 217
ScrFI CCNGG 1 cut(s) 62
SduI GDGCHC 1 cut(s) 143
SetI ASST 3 cut(s) 73, 258, 302
SfaNI GCATC 2 cut(s) 76, 256
SmiMI CAYNNNNRTG 1 cut(s) 113
SphI GCATGC 1 cut(s) 112
Sse9I AATT 1 cut(s) 202
SsiI CCGC 1 cut(s) 153
SspMI CTAG 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 60
TaaI ACNGT 2 cut(s) 213, 241
TasI AATT 1 cut(s) 202
TatI WGTACW 2 cut(s) 158, 236
TauI GCSGC 1 cut(s) 155
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TscAI CASTG 1 cut(s) 216
TspDTI ATGAA 2 cut(s) 17, 131
TspRI CASTG 1 cut(s) 216
Van91I CCANNNNNTGG 1 cut(s) 227
XapI RAATTY 1 cut(s) 202
XbaI TCTAGA 1 cut(s) 175
XceI RCATGY 2 cut(s) 112, 159
XmiI GTMKAC 1 cut(s) 12
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.