RchiOBHm_Chr2g0110371

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
21846128 .. 21846304
177 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGTTTGTGTTCTTGTGGGCTACCCAGGCAGGTTTGGTGGCGTTTAGAGAGATGGGTTTGATTGGAGTGAAACCCAATGCAGTGACGGTGTTGATGATCCTGCATGCTTGCTCTGAGTCGAGGGATTTGAATTCGGGATCAATTCATCATCGAGATGTTCATGATGAAATTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.46

Weight (kDa)

5.68

Isoelectric Point (pI)

40.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 20
AclWI GGATC 2 cut(s) 91, 145
AcsI RAATTY 1 cut(s) 130
AgsI TTSAA 1 cut(s) 130
AjnI CCWGG 1 cut(s) 24
AlwI GGATC 2 cut(s) 91, 145
ApoI RAATTY 1 cut(s) 130
BccI CCATC 1 cut(s) 46
BciT130I CCWGG 1 cut(s) 26
BfuAI ACCTGC 1 cut(s) 20
Bme1390I CCNGG 1 cut(s) 26
BmrFI CCNGG 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 24
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 105
Bsp143I GATC 2 cut(s) 96, 137
BspCNI CTCAG 1 cut(s) 106
BspHI TCATGA 1 cut(s) 160
BspMI ACCTGC 1 cut(s) 20
BspPI GGATC 2 cut(s) 91, 145
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 2 cut(s) 96, 137
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 88
BstC8I GCNNGC 2 cut(s) 105, 109
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 2 cut(s) 99, 140
BstMBI GATC 2 cut(s) 96, 137
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 26
BstNSI RCATGY 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 24
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 1 cut(s) 87
BveI ACCTGC 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 105, 109
CciI TCATGA 1 cut(s) 160
CviAII CATG 2 cut(s) 104, 161
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
DdeI CTNAG 1 cut(s) 114
DpnI GATC 2 cut(s) 98, 139
DpnII GATC 2 cut(s) 96, 137
EcoRI GAATTC 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 24
FaeI CATG 2 cut(s) 107, 164
FaiI YATR 2 cut(s) 105, 162
FatI CATG 2 cut(s) 103, 160
Hin1II CATG 2 cut(s) 107, 164
HinfI GANTC 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 3 cut(s) 135, 152, 161
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4V TGCA 2 cut(s) 80, 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 107, 164
Kzo9I GATC 2 cut(s) 96, 137
LpnPI CCDG 4 cut(s) 11, 15, 38, 113
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 98, 139
MboI GATC 2 cut(s) 96, 137
MluCI AATT 3 cut(s) 130, 141, 168
MlyI GAGTC 1 cut(s) 125
MnlI CCTC 1 cut(s) 114
MslI CAYNNNNRTG 1 cut(s) 153
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 2 cut(s) 96, 137
NlaIII CATG 2 cut(s) 107, 164
NmuCI GTSAC 1 cut(s) 82
NspI RCATGY 1 cut(s) 107
PaeI GCATGC 1 cut(s) 107
PagI TCATGA 1 cut(s) 160
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
RseI CAYNNNNRTG 1 cut(s) 153
Sau3AI GATC 2 cut(s) 96, 137
SchI GAGTC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 26
SetI ASST 1 cut(s) 34
SmiMI CAYNNNNRTG 1 cut(s) 153
SphI GCATGC 1 cut(s) 107
Sse9I AATT 3 cut(s) 130, 141, 168
StyD4I CCNGG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 88
TaqI TCGA 2 cut(s) 119, 151
TasI AATT 3 cut(s) 130, 141, 168
TscAI CASTG 1 cut(s) 87
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 134, 149
TspRI CASTG 1 cut(s) 87
XapI RAATTY 1 cut(s) 130
XceI RCATGY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.