Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8025774.1

Orthogroup ID

OG0004226

Physical Location & Seq

Genomic Coordinates Forward (+)

105 .. 464

Gene Structure 360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8025774.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atgaatcacttggtagaaggattgctccttccaatctttacactcaagagacgtgggttgctcagggaagctataaacctctacacttcactcagatctcggaacaatgctcctgacaatcttctgcttctctctgttgccaaggcttgtgcggttttgggtaatctcagaaaagcaacagagcttcatgatgaggcaattctgttcgggtttcatttggatattgctttgggcaatgccatggttgaaatgtctgggaagtgtatgttgatggggcaaggggggtttgggggtttcgatgaaatgatgcccgtgaaggatgtcatttcttggacatgtttgtgttcttattatgtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

119

Amino Acids

13.15

Weight (kDa)

6.81

Isoelectric Point (pI)

49.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004226)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g15940
malus_domestica	MD02G1167400.v1.1 MD05G1214500.v1.1 MD05G1214600.v1.1 MD05G1216500.v1.1 MD05G1217200.v1.1 MD10G1199000.v1.1
prunus_persica	Prupe.4G142900_v2.0.a1
pyrus_communis	pycom05g19880 pycom05g19900 pycom10g17150
rosa_chinensis	RchiOBHm_Chr2g0110371 RchiOBHm_Chr5g0026861
rosa_laevigata	RLG00000006394 RLG00000024474 RLG00000027454 RLG00000032965 RLG00000034129
rosa_multiflora	Rmu_co8025774.1_g000001 Rmu_sc0012328.1_g000003 Rmu_ssc0000172.1_g000017
rosa_roxburghii	Rroxscaffold_1G00052620 Rroxscaffold_1G00052640
rosa_rugosa	Rorug05G0430800
rosa_samantha	Rh1BG148800 Rh1DG180700 Rh2CG220800 Rh5AG488400 Rh5BG186400 Rh5CG205600 Rh7CG473500 Rh7DG442800
rosa_wichuraiana	Rw5G017180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	152
AflIII	ACRYGT	1 cut(s)	335
AgsI	TTSAA	1 cut(s)	248
AjiI	CACGTC	1 cut(s)	53
AluBI	AGCT	2 cut(s)	71, 184
AluI	AGCT	2 cut(s)	71, 184
Alw26I	GTCTC	1 cut(s)	43
BccI	CCATC	1 cut(s)	265
BcoDI	GTCTC	1 cut(s)	43
BglII	AGATCT	1 cut(s)	95
BmgBI	CACGTC	1 cut(s)	53
BmsI	GCATC	1 cut(s)	297
Bpu10I	CCTNAGC	1 cut(s)	62
BpuEI	CTTGAG	1 cut(s)	29
BsaJI	CCNNGG	2 cut(s)	141, 240
Bse3DI	GCAATG	1 cut(s)	241
BseDI	CCNNGG	2 cut(s)	141, 240
BseGI	GGATG	1 cut(s)	325
BseMI	GCAATG	1 cut(s)	241
BseMII	CTCAG	3 cut(s)	76, 106, 181
BsmAI	GTCTC	1 cut(s)	43
BsmBI	CGTCTC	1 cut(s)	43
Bsp143I	GATC	1 cut(s)	95
Bsp19I	CCATGG	1 cut(s)	240
BspACI	CCGC	1 cut(s)	152
BspCNI	CTCAG	3 cut(s)	75, 105, 180
BspHI	TCATGA	1 cut(s)	187
BsrDI	GCAATG	1 cut(s)	241
BssECI	CCNNGG	2 cut(s)	141, 240
BssMI	GATC	1 cut(s)	95
BssT1I	CCWWGG	2 cut(s)	141, 240
BstDEI	CTNAG	3 cut(s)	62, 92, 167
BstDSI	CCRYGG	1 cut(s)	240
BstF5I	GGATG	1 cut(s)	325
BstKTI	GATC	1 cut(s)	98
BstMAI	GTCTC	1 cut(s)	43
BstMBI	GATC	1 cut(s)	95
BstNSI	RCATGY	1 cut(s)	339
BstX2I	RGATCY	1 cut(s)	95
BstYI	RGATCY	1 cut(s)	95
BtgI	CCRYGG	1 cut(s)	240
BtrI	CACGTC	1 cut(s)	53
BtsCI	GGATG	1 cut(s)	325
CciI	TCATGA	1 cut(s)	187
CspCI	CAANNNNNGTGG	2 cut(s)	34, 69
CviAII	CATG	3 cut(s)	188, 241, 336
CviJI	RGCY	3 cut(s)	71, 146, 184
CviKI_1	RGCY	3 cut(s)	71, 146, 184
DdeI	CTNAG	3 cut(s)	62, 92, 167
DpnI	GATC	1 cut(s)	97
DpnII	GATC	1 cut(s)	95
Eco130I	CCWWGG	2 cut(s)	141, 240
EcoT14I	CCWWGG	2 cut(s)	141, 240
ErhI	CCWWGG	2 cut(s)	141, 240
Esp3I	CGTCTC	1 cut(s)	43
FaeI	CATG	3 cut(s)	191, 244, 339
FaiI	YATR	6 cut(s)	74, 189, 242, 266, 337, 354
FatI	CATG	3 cut(s)	187, 240, 335
FokI	GGATG	1 cut(s)	332
Hin1II	CATG	3 cut(s)	191, 244, 339
HinfI	GANTC	1 cut(s)	4
Hpy188I	TCNGA	3 cut(s)	95, 102, 170
Hpy188III	TCNNGA	3 cut(s)	46, 113, 188
HpyAV	CCTTC	3 cut(s)	11, 38, 310
HpyCH4IV	ACGT	1 cut(s)	52
HpyF3I	CTNAG	3 cut(s)	62, 92, 167
HpySE526I	ACGT	1 cut(s)	52
Hsp92II	CATG	3 cut(s)	191, 244, 339
Kzo9I	GATC	1 cut(s)	95
LmnI	GCTCC	2 cut(s)	30, 115
LpnPI	CCDG	3 cut(s)	49, 126, 240
LweI	GCATC	1 cut(s)	297
MaeII	ACGT	1 cut(s)	52
MalI	GATC	1 cut(s)	97
MboI	GATC	1 cut(s)	95
MboII	GAAGA	1 cut(s)	113
MflI	RGATCY	1 cut(s)	95
MluCI	AATT	1 cut(s)	198
MnlI	CCTC	2 cut(s)	89, 187
MslI	CAYNNNNRTG	1 cut(s)	340
NcoI	CCATGG	1 cut(s)	240
NdeII	GATC	1 cut(s)	95
NlaIII	CATG	3 cut(s)	191, 244, 339
NspI	RCATGY	1 cut(s)	339
PagI	TCATGA	1 cut(s)	187
PciI	ACATGT	1 cut(s)	335
PfeI	GAWTC	1 cut(s)	4
PscI	ACATGT	1 cut(s)	335
PsuI	RGATCY	1 cut(s)	95
RseI	CAYNNNNRTG	1 cut(s)	340
Sau3AI	GATC	1 cut(s)	95
SetI	ASST	4 cut(s)	55, 73, 81, 186
SfaNI	GCATC	1 cut(s)	297
SmiMI	CAYNNNNRTG	1 cut(s)	340
SmlI	CTYRAG	1 cut(s)	44
SmoI	CTYRAG	1 cut(s)	44
Sse9I	AATT	1 cut(s)	198
SsiI	CCGC	1 cut(s)	152
StyI	CCWWGG	2 cut(s)	141, 240
TaiI	ACGT	1 cut(s)	55
TaqI	TCGA	1 cut(s)	297
TasI	AATT	1 cut(s)	198
TfiI	GAWTC	1 cut(s)	4
TspDTI	ATGAA	4 cut(s)	17, 176, 203, 315
XceI	RCATGY	1 cut(s)	339

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.