RchiOBHm_Chr1g0336171

Wall-associated receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
27841221 .. 27841421
201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGCCAAGTCCCAGACTGATCAGTTTGTTAATGAGGTGGTTGTTCTCTCTCAAATAAACCATAGAAATATGGTGAAGCTTTTAGGTTGCTGTTTAGAGACAGAAATGCCTTTACTAGTTTATGAGTACGTTAGCAATGGCACTCTTTATGACCACATTCATAAAAGAAATGGAAAACGTCCACTTTCATTAGGATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

66

Amino Acids

7.55

Weight (kDa)

7.83

Isoelectric Point (pI)

50.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 3 - 59 1.7e-11 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 3 - 56 3.4e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 128
AhlI ACTAGT 1 cut(s) 115
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 92
AoxI GGCC 1 cut(s) 3
AsuHPI GGTGA 1 cut(s) 85
BalI TGGCCA 1 cut(s) 5
BclI TGATCA 1 cut(s) 19
BcoDI GTCTC 1 cut(s) 92
BcuI ACTAGT 1 cut(s) 115
BfaI CTAG 1 cut(s) 116
Bse3DI GCAATG 1 cut(s) 142
BseMI GCAATG 1 cut(s) 142
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 92
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 19
BspANI GGCC 1 cut(s) 5
BsrDI GCAATG 1 cut(s) 142
BssMI GATC 1 cut(s) 19
BstKTI GATC 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 19
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 127
CviJI RGCY 2 cut(s) 5, 79
CviKI_1 RGCY 2 cut(s) 5, 79
CviQI GTAC 1 cut(s) 127
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
EaeI YGGCCR 1 cut(s) 3
FaiI YATR 5 cut(s) 63, 71, 123, 150, 162
FbaI TGATCA 1 cut(s) 19
FspBI CTAG 1 cut(s) 116
HaeIII GGCC 1 cut(s) 5
HindIII AAGCTT 1 cut(s) 77
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 182
HpyCH4IV ACGT 2 cut(s) 129, 178
HpySE526I ACGT 2 cut(s) 129, 178
Ksp22I TGATCA 1 cut(s) 19
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 1 cut(s) 26
MaeI CTAG 1 cut(s) 116
MaeII ACGT 2 cut(s) 129, 178
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 28
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 30
Msp20I TGGCCA 1 cut(s) 5
NdeII GATC 1 cut(s) 19
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 1 cut(s) 19
SetI ASST 5 cut(s) 39, 81, 88, 132, 181
SgeI CNNG 3 cut(s) 19, 25, 128
SpeI ACTAGT 1 cut(s) 115
SspMI CTAG 1 cut(s) 116
TaiI ACGT 2 cut(s) 132, 181
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 149, 177
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.